Busch Lab

ZMP

pcdh1

Ensembl ID:
ENSDARG00000036175
Human Orthologue:
PCDH1
Human Description:
protocadherin 1 [Source:HGNC Symbol;Acc:8655]
Mouse Orthologue:
Pcdh1
Mouse Description:
protocadherin 1 Gene [Source:MGI Symbol;Acc:MGI:104692]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa17938 Nonsense Available for shipment Available now
sa35735 Nonsense Mutation detected in F1 DNA Not yet available
sa10175 Nonsense Available for shipment Available now
sa42430 Nonsense Mutation detected in F1 DNA Not yet available
sa35736 Nonsense Mutation detected in F1 DNA Not yet available
sa28349 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 9 1093 1 4
Genomic Location (Zv9):
Chromosome 14 (position 38827707)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37212860
GRCz11 14 37553174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTTTTGCAGCAACAGACTGACGATGTGYCAGAGTGCCAATGCGATGTG[G/A]TCACGGTGGAGTGCCATGCTAGWGTGGATTTTGCTTCTCCTCTGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35735
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 208 1093 1 4
Genomic Location (Zv9):
Chromosome 14 (position 38828303)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37213456
GRCz11 14 37553770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGGTGGCACAAGACTCTGACGAGAAATTACCGCAACTCATTGTAT[T/A]GGGTAACCTGGATAGAGAACTGCGAGATTCATACGACCTCAATATAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10175
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 290 1093 2 4
ENSDART00000105588 Nonsense 290 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830121)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37215274
GRCz11 14 37555588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGGTGAAGRCCAATGACTCTGACATGGGACCCAATGGTGAGGTTACCTA[C/A]AGCCTCCATCAGCCATCATCACCAGTGATGAGACTTCTAAGCATTGACCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7746
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 290 1093 2 4
ENSDART00000105588 Nonsense 290 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830121)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37215274
GRCz11 14 37555588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGGTGAAGGCCAATGACTCTGACATGGGACCCAATGGTGAGGTTACCTA[C/A]AGCCTCCATCAGCCATCATCACCAGTGATGAGACTTCTAAGCATTGACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42430
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 363 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830338)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37215491
GRCz11 14 37555805
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTATCACAGTGAAAGATCAGAATGACAACGCACCCTCCATTAGAATC[C/T]GAGGCATTGGCCTTGTAACGCATGAAGATGGTGTCGCTAACATATCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Nonsense 551 1093 2 4
Genomic Location (Zv9):
Chromosome 14 (position 38830904)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37216057
GRCz11 14 37556371
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGAAGTGCGTGTCATGAGCCAGTTGGACCGTGAACAATTAGATCACTA[T/A]CAATTTCTGGTCGCAGCAGCTGATAAAGGTGTACCAAGCCTAAGAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28349
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105588 Essential Splice Site 1003 1093 3 4
Genomic Location (Zv9):
Chromosome 14 (position 38987028)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 37372181
GRCz11 14 37712495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATCGGCTTGTCCACTGACCTTTGACTTCTCTCTCTCTCTCCAATCAC[A/C]GCTCCCACATCGCCGAGTGACCTTCTCCACAGCCAATCAGGCGCAGGATC
Associated Phenotype:
Not determined