Busch Lab

ZMP

hnrnpa0l

Ensembl ID:
ENSDARG00000036161
ZFIN ID:
ZDB-GENE-030131-618
Description:
Hnrpa0l protein [Source:UniProtKB/TrEMBL;Acc:Q7ZU48]
Human Orthologue:
HNRNPA0
Human Description:
heterogeneous nuclear ribonucleoprotein A0 [Source:HGNC Symbol;Acc:5030]
Mouse Orthologue:
Hnrnpa0
Mouse Description:
heterogeneous nuclear ribonucleoprotein A0 Gene [Source:MGI Symbol;Acc:MGI:1924384]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18044 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052511 Nonsense 124 302 1 1
Genomic Location (Zv9):
Chromosome 14 (position 40346381)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38509615
GRCz11 14 38849929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCGAGGACGAACACCTTCAAGATTATTTCTCACAGTTTGGGCCCATC[G/T]ARAAGGCGCAGGTCATMACCGACAAAGACACCGGGAAGAAGCGAGGCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2757
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052511 Nonsense 196 302 1 1
Genomic Location (Zv9):
Chromosome 14 (position 40346597)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38509831
GRCz11 14 38850145
KASP Assay ID:
554-2977.1 (used for ordering genotyping assays)
KASP Sequence:
AGTCCACCGGTGGCGGTCGCGGCGGCAGAGGAGGCCGAGGAATGGGCCGG[G/T]GAAGCGGCTTTGGTGGCGGCGGAAGAGGGGGTTACTATAACGACTACGGC
Associated Phenotype:
Not determined