Busch Lab

ZMP

nudcd1

Ensembl ID:
ENSDARG00000036158
ZFIN ID:
ZDB-GENE-050522-483
Description:
NudC domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q503C8]
Human Orthologue:
NUDCD1
Human Description:
NudC domain containing 1 [Source:HGNC Symbol;Acc:24306]
Mouse Orthologue:
Nudcd1
Mouse Description:
NudC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914679]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43276 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23515 Nonsense Available for shipment Available now
sa43275 Nonsense Mutation detected in F1 DNA Not yet available
sa23514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43276
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Essential Splice Site 347 585 6 10
Genomic Location (Zv9):
Chromosome 19 (position 23293452)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23222867
GRCz11 19 22807190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTTGACCCCGAGGCCAGCACTTGGACCATGAATGATGATAAGAGG[T/G]AAAAGAAATACAAGTAAAGCTTATTACTGCACTTTTCATGTTGGAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 348 585 7 10
Genomic Location (Zv9):
Chromosome 19 (position 23275196)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23204611
GRCz11 19 22788934
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACAAAAGTTTATCTGGATTTTTGTTGTTGTTGTTGTTGTGTGTAGTT[T/A]GGAAGTCAGTCTACAGAAGCGAAGTGAAGGCCCACTATGGTCCGAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43275
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 379 585 7 10
Genomic Location (Zv9):
Chromosome 19 (position 23275104)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23204519
GRCz11 19 22788842
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAAGTGGTTTTGGGGGACCGGAGAGGAGAGTATCTGATGAATGATGAA[C/T]AGAAATCACAGCTCCAGCAGAGGCTCTCGTATCTCACTTCTGAGGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052503 Nonsense 524 585 10 10
Genomic Location (Zv9):
Chromosome 19 (position 23245809)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23175224
GRCz11 19 22759547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTCTCCTACGCTGCCCTTTGTGAGTGCCTCAGACGCATCTTCATTTA[T/A]CGCCAGCCCTCGCCGGTCGACACGGTGCTCTTCAACCGGAAACAGGGTCG
Associated Phenotype:
Not determined