Busch Lab

ZMP

ano5b

Ensembl ID:
ENSDARG00000036147
ZFIN ID:
ZDB-GENE-061215-108
Description:
anoctamin 5b [Source:RefSeq peptide;Acc:NP_001073452]
Human Orthologue:
ANO5
Human Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Mouse Orthologue:
Ano5
Mouse Description:
anoctamin 5 Gene [Source:MGI Symbol;Acc:MGI:3576659]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40934 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40934
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099919 Essential Splice Site 355 890 8 18
ENSDART00000132504 None None 167 None 4
ENSDART00000141828 Essential Splice Site 380 915 9 19

The following transcripts of ENSDARG00000036147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 34192316)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32586656
GRCz11 7 32857806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGATAATGAAGGAACTGTGTTTTTTGCCATGTTCATGGGCATTTGGGG[T/G]GAGTATACTGCCTTTTTTTTCTAGCTTAGTAGCGCCATCTAGTGCATGGC
Long Flanking Sequence:
CATTGTCTCATAACTTAATTTAAAAGTGAAGGCATGAACTCTAGAGGCCTCTTGATATTTTTGTTGGTTTTTCCCTATAGCTCTCACTAATGATTGTTTTGGATCATGCTTAACAGTAGTTGATTTGTTCCAAATTCTCCATGGTGTCTTTGCACTGTTTTTTTTCCCCAGCATGCATAATGAAGATCTGTTGATATTCCCTTCTGCAACATTTCTCCCCTGTCACTTTTTCTCTTTGTGTTTTCAGTAAGGAAATCTGTGACCCAAAAATAGGAGGCATGATTGTCATGTGTCCGCTCTGTGACAAAAAGTGCAGCTACTGGAAACTCAACTCAACATGTCTGTCCTCCTGGGTGAAAACAAGCACTGTTTAAATTGTAAATAACTATTTATTAATCGTATACAGTTTCCTAATTTCTGATCCCTTTTTTTTCTTAGCAATCCCATCTCTTTGATAATGAAGGAACTGTGTTTTTTGCCATGTTCATGGGCATTTGGGG[T/G]GAGTATACTGCCTTTTTTTTCTAGCTTAGTAGCGCCATCTAGTGCATGGCTGGACATTTGTAGTAGCCCCACTCAGAATCTAATGAGAATGAGATCATAATAGCCATGCATGAAGCATTTTAGCGTATTCTTAATGTCAAATAATTGGCCACAGGATTTGTTCACTATATAAATCTACAATAGAGGAGCATAATTTGTGTATGCTTTTTGAAAATGAAATCTGTAATGACTAATGATGCTCACTGATTATCCATTACTGAACACTGAATTAATTTCTCACATGGCTCAAAATGAGCTCTGCTTATGCAGGGATTTGATTAATCAGCACTGTGGATATTCTTTTATCCAGTGTCCTCATTAATTAAAACTGTTTATGTTGCTGCTGAATCTTTGGACTTGAGTACTGTAATGTTAATGAAAGAAAAACAGAGTGTGACTGAAGAGATAAACCTGGTTGGATTTGAATAGAACTAATATTTAGGGTTTGTTCACGCAAAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5425
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099919 Nonsense 572 890 13 18
ENSDART00000132504 None None 167 None 4
ENSDART00000141828 Nonsense 597 915 14 19

The following transcripts of ENSDARG00000036147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 34183184)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32577524
GRCz11 7 32848674
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTAAAGATTTGGATGTTTTTCATGTTTAGTGTGCTCCTGGAGGTTG[T/A]CTGATTGAGCTGACCACTCAGCTRCTTATTGTCATGGCTGGGAAACAAAT
Long Flanking Sequence:
AAAATGTATGTGCAATCTCTAAGTTTAGTTAGTCATTATTATTACTAAAGAACACTGGGTGCTTTTTTTAATATAACTGACTGTACATTCCCCCCTGACATGTTTATCTTAAACAGTATGAAAAACATTTGCCATTATCTCTCATCTATTTTTAACCCTCAGAAATCCCCAAGACCCATCTGGAGTATGAGAACAAGCTGACCATGAAGATGTTCATGTTCCAGTTTGTGAACTACTACTCTTCCTGTTTCTATGTGGCCTTCTTTAAGGGAAAGTTTGTGGGTTATCCGGGAAACTACAGTTATATGTTTGGAAAGTGGAGCACTTTGAGAAATGAGGAGGTGAGACTCCATGAAATATTACTGTGCTTCACAACCTAATGTTCTTCAGCTGAATTTCACAATATTTTTTGACCTTGTATTTGTTAACTCTTCACTTTTTGAGGGAACCTTTTTTAAAGATTTGGATGTTTTTCATGTTTAGTGTGCTCCTGGAGGTTG[T/A]CTGATTGAGCTGACCACTCAGCTGCTTATTGTCATGGCTGGGAAACAAATGGTCGGGAACGTCCAAGAGGCTCTTTTGCCGTAAGCTTTACAATTTGACATCTATAATTGAGCTAGTGTCTGTTTTAATGCTTGAATATTTGGTTGCATGCATTTTAAGGAGGTCAGAATGTAGTTGTCCTCTAGACAGTTTTCAAATCCCATGTAACCGAGTGAGTAATGGTCCCTTGTGTCACAGACTTGTCCGAAACTGGTGGAGCAGCAGGAAAGGCCGCAGTCATCCAGAAAGCACGTATAGTAGATGGGAGCAGGACCATGACCTCCAGAACTTCAGCCAGTTTGGACTCTTCTATGAGTATCTGGAGATGGGTACGAGTTTACTCTGATATCCATTTTATTTTTTTGCGTTTCTTTTAAATAGTGAATAATAGTTTGTAGATTCACAAAATATATATTTTTTTTACAATACAGTACTCTTCAAAACCTACATTCATAAGTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26984
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099919 Nonsense 871 890 18 18
ENSDART00000132504 None None 167 None 4
ENSDART00000141828 Nonsense 896 915 19 19

The following transcripts of ENSDARG00000036147 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 34170855)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32565195
GRCz11 7 32836345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGGAGAAACTGAAGATGCAGCTAAGCCAGAGTTTCTGCCTATCCACA[G/T]AAACGGCCTCACTGCTGCCCTCTAGTCCAAACAAACACCAGGTGATTTCT
Long Flanking Sequence:
CTAGTAATTTAGTCCTCCAAACAATTTAACAATGTACTTTTATGTATTAAGTCGGGACATGATAAATAGAGCTGAGGTATGGGACTGTCCTGGGAAAAGTTGAATGTCAGGTCACCCTACTCTCATTTTTGGTCAGCCACATAAATCCCTCTTTCTTTGCCTTTTTACCACAGTTTTTTTCTCTGTGCCTTCAGTCTGTCCTGACAGTGAGTGTAAAATCACTAGAGGATTTGCGCTGATCAAGCCGATTGTAAATACGGCCTGAAACATGCACTTTTGGTTTTCTGCACACATGAATGATGGATGTTCCTCTGTTTCTTCTGCTTTCTCAGCATGTTGTGTTTGTGGTAAAGTTCTTCGTGGCGTGGCTCATCCCAGATGTGCCTTCAGAAGTGAAAGCCCGTATAAAGCGTGAGCGCTTTCTGGTCCAGGAATACCTGCACAACTATGAAGTGGAGAAACTGAAGATGCAGCTAAGCCAGAGTTTCTGCCTATCCACA[G/T]AAACGGCCTCACTGCTGCCCTCTAGTCCAAACAAACACCAGGTGATTTCTGAATGTGTCTGAACATCCTCAGGAGGACTACACTTAGATGTACTGTACACTGCAAAGCATGAAGGACTCCTTCATACTGTACATTCAGTGCTAAAAAATAACTCGCCCTCACTCAGACAACTGCCAGAAGTTTTACAAACAGCTCTAAATGTGAAACAACTATACGGTCTGCTTTCATTTTGCTCAAGGTTTATCAGAGAACGTCAGCTTTTGCAATGGATAAAAATGGCAGTGAATTCAACAGCAAACCTTCTGGAATGCAACCCGATGCTCCTCCAGGTGCTGTGAAGGCAACTCGTAAACAATCAGGAAAATCACCATTAAAAAAAGACATTCGGAAATGTTTTAAGAAGGCATTAAGTGTTTCTCTGTCCAGCTTGTTGCCATCTTTGATTTGAAGACATAATCTGCATGCTTTGCTCTGTATGTCTGACTGTGAAAGAGCTCCTC
Associated Phenotype:
Not determined