Busch Lab

ZMP

si:dkeyp-92c9.3

Ensembl ID:
ENSDARG00000036104
ZFIN ID:
ZDB-GENE-060503-562
Description:
myosin-Ig [Source:RefSeq peptide;Acc:NP_001038686]
Human Orthologue:
MYO1G
Human Description:
myosin IG [Source:HGNC Symbol;Acc:13880]
Mouse Orthologue:
Myo1g
Mouse Description:
myosin IG Gene [Source:MGI Symbol;Acc:MGI:1927091]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa44915 Nonsense Mutation detected in F1 DNA Not yet available
sa43284 Nonsense Mutation detected in F1 DNA Not yet available
sa17276 Nonsense Available for shipment Available now
sa14281 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44915
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Nonsense 206 1010 5 22
ENSDART00000142774 Nonsense 206 998 5 22
Genomic Location (Zv9):
Chromosome 19 (position 25223230)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25153342
GRCz11 19 24737565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAGTTGTTCAGCAGCAAGAAGGAGAAAGAAACTTCCATTCATTTTAT[C/T]AGGTGAGACCTTCTTCCAAGTTTTAGTAAATGAGATTGTATGATATTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43284
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Nonsense 209 1010 6 22
ENSDART00000142774 Nonsense 209 998 6 22
Genomic Location (Zv9):
Chromosome 19 (position 25223093)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25153205
GRCz11 19 24737428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTCAGTATGTAAGTTAATATTCACGTGTTGTGTTTATGCAGTTGTTA[C/T]GAGGAGGGTCTGATGATTTGCTCAAGTCCTTATATCTACAGAGAGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17276
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Nonsense 460 1010 11 22
ENSDART00000142774 Nonsense 460 998 11 22
Genomic Location (Zv9):
Chromosome 19 (position 25218314)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25148426
GRCz11 19 24732649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGGATTTAGTGGAGCAGCCYCAYAAGGGGATYATCTCYGTTCTGGAT[G/T]AAGCCTRTCTCATTGCAGGGAAAGTCACAGAYACAGTTTGCCTGGACAKC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3046
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Nonsense 535 1010 13 22
ENSDART00000142774 Nonsense 535 998 13 22
Genomic Location (Zv9):
Chromosome 19 (position 25202508)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25132620
GRCz11 19 24716843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGATGGCTTTCTTGATAAGAACAAGGACCCGCTTTTTCAAGATTTCAAG[C/T]GACTGATGTACAACAGGTAGTGGTTTTAACCTTTCTTTCAACAAAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Essential Splice Site 540 1010 13 22
ENSDART00000142774 Essential Splice Site 540 998 13 22
Genomic Location (Zv9):
Chromosome 19 (position 25202490)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25132602
GRCz11 19 24716825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACAAGGACCCGCTTTTTCAAGATTTCAAGYGAYTGATGTACAACAGG[T/C]AGTGGTTTTAACCTTTCTTTCAACAAAATAATCAAWATGTCCAAAARAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4081
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052418 Essential Splice Site 832 1010 18 22
ENSDART00000142774 Essential Splice Site 832 998 18 22
Genomic Location (Zv9):
Chromosome 19 (position 25191224)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25121336
GRCz11 19 24705559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATRGACTGGGGCTACAGCCGTTCCTGGGAGAGAGACTACTTGGCCAATG[T/C]RAGTTTTTCATTTAGATGCTTATTTTGAATTTTCACTTTGCTTAGTGTGC
Associated Phenotype:
Not determined