Busch Lab

ZMP

eya3

Ensembl ID:
ENSDARG00000036100
ZFIN ID:
ZDB-GENE-060503-864
Description:
eyes absent homolog 3 [Source:RefSeq peptide;Acc:NP_001073521]
Human Orthologue:
EYA3
Human Description:
eyes absent homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:3521]
Mouse Orthologue:
Eya3
Mouse Description:
eyes absent 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109339]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa29209 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29209
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049840 Essential Splice Site 417 609 14 19
ENSDART00000132209 Essential Splice Site 425 617 14 19
Genomic Location (Zv9):
Chromosome 19 (position 25391215)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25321327
GRCz11 19 24905550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTCCATGTTGATGATGTTGCCTCGGATGACAATGGACAGGATTTGAGG[T/C]AAACATGGTCAAAACTTATAATTACAGTTCTTTAAGTGACCATAACATTA
Associated Phenotype:
Not determined