Busch Lab

ZMP

itga11a

Ensembl ID:
ENSDARG00000036086
ZFIN ID:
ZDB-GENE-050324-1
Description:
integrin, alpha 11a [Source:RefSeq peptide;Acc:NP_001166098]
Human Orthologue:
ITGA11
Human Description:
integrin, alpha 11 [Source:HGNC Symbol;Acc:6136]
Mouse Orthologue:
Itga11
Mouse Description:
integrin alpha 11 Gene [Source:MGI Symbol;Acc:MGI:2442114]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13635 Nonsense Available for shipment Available now
sa18873 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9327 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Nonsense 454 1228 11 30
ENSDART00000127081 Nonsense 416 1190 11 30
Genomic Location (Zv9):
Chromosome 7 (position 34542221)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32936561
GRCz11 7 33207711
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAGGAGACTCGGCAAGGGAAAGTGGKTCCACCGAAWTCCTCCTATGAA[C/T]AAGAGTTCCCAGAAGAACTAAAGAACCATGGAGCCTACCTGGGTAAAAAA
Long Flanking Sequence:
TTTGATTTGTCATATGTTTCATATGTTTTGATTACTTCTGTTTGTAAGTTATTTTGGACAAAAACATCTGCCGAGTATAAATTCTACATGTGTATTTTATTTGATGCCAATGTCACTAACATTTATTTATTTATTATTTATTACTTTATTAATGTAGTGCCGTTGACAGCAAATGCACATCAATGTAAAATTAGCTTCAGCAATGCTCTCAGGTCTCATAAAAGAAAATGCGAAAGATGGAAGATTTGGCAAGTTAAAACGCAATAAATGTCTTCATTCATTCGTTTAATGGCCCAGAGTCTGTAGTTTGATGCCATAAGGGTTGACAGAAATAAAGAATATGGTTAGTTTCCTGAATTTTATGTGATTGTGTATATATTGGTATGCTCTGTCTGCAGGATGGTATTTTAGTGGGAGCTGTGGGAGCTTATGACTGGAACGGCGCTGTGCTAAAGGAGACTCGGCAAGGGAAAGTGGTTCCACCGAAATCCTCCTATGAA[C/T]AAGAGTTCCCAGAAGAACTAAAGAACCATGGAGCCTACCTGGGTAAAAAATGCACACTTACTGTACGCATTAATCAGGGCTATCAGTGCTTATAGCAGAAAAACGCCTCGATCTATTATCTGTCTATCTCTGTTAATGATTACTTTTCATTTAATACTCTTTTTTTCCTCATGTTGGCAAGAGATACACACACTCTGTGTTGGGTGTTATTAGTTACAAAGTAACTACTGTAATTGAATTAGTTTTTAATACAAGTTTACTGTAATTTAATTACAGTTACTACAAAATACTTGTCTTGAATACTGTACCTATATTCAACAGTTCTATATAAATCAATTCGAAGAAGCAGAATAATATATATAATTTATGTTTTTAATATTTTTTATAATTTTGGAATAATTATATTTTTCAAAAATCATTTGTCATTTGTCAAGACAATTGCATATGCTTAAGAAAGAAATTAGTTGATGAATATATGTGAAATTTCTGCCATAAAACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5427
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Nonsense 735 1228 17 30
ENSDART00000127081 Nonsense 697 1190 17 30
Genomic Location (Zv9):
Chromosome 7 (position 34530527)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32924867
GRCz11 7 33196017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAAACATATTAAGTTCTAAAGCTATTTTCTTGCACTTCTCTTAGCTCTT[A/T]GAKACAGTGCTTTCTTTGAGGAGAARCGCTTYAACCCTCGGGCTGTATTT
Long Flanking Sequence:
TGTGCTACCCACTGTGCCACCGTGCTGCCCCTACAATGCATTTGTGCATTTTTTTTTATCTAAATTTGACAAATCAGATGGGGCCGTACCCCTCCTTCCTAGTAGTTGATGTTCTGCTATTGGCTGGAGTGGCCCACAGATGAACCCAGAACTGAAATTAAACACTTATGGAGGGCGAGAGATTGACAACAGCCAATCAGAATATCCGATCACTTATTTATAGTGTTTTAAAGACTAAACGCATGCACTTTTACAGTTTTTTTCATTAATTTGATTTTAATTTATTTATATTTATTTAAATATCATTAAATATGTAAATAATTAAAAACACAGTCAATAAAAATAGCATTTTTTCTACAGAAGTGTTATTTTGTAAAAAATATTGTTTTCCCAATAATCAACAACAACATTGCATGTTTTTCCAGTATCGCGCAGCCCTTGTTAAATACTGCAAACATATTAAGTTCTAAAGCTATTTTCTTGCACTTCTCTTAGCTCTT[A/T]GATACAGTGCTTTCTTTGAGGAGAAGCGCTTTAACCCTCGGGCTGTATTTGATGATCCAGATCGCCAGCAGCCACAAAACCTCACACTGCTTCCTGGAGAGGAGACCTGTGATCACATCTACTTCCACGTCATGGTTAGTTCTCACTTTACTCAGGTCACCAAAGTAGAATGAAGATGAATTTGCACTGCATTTAAAATCCCTGATAATTCTAACATAATCATCAGTGATGGCCAACTATAATAACAATCCATTCAATTGTTCATTCAGATTTTCCACTGCAACTGCAGCATTCCGGTTTTAATAACTTCACTTTCTAGCATTACAACAGCAGATCATGTTCTTCCAGTTTACTCTTTTATAGCGATATATATTTAGAGTGAGAGATTTATGATATTGTAATGTTGATACAGGAGACTACAGACTACGCCAGGCCAATTATATTCACTGTAGAGACGGAGCTTTTGGACCTGTATCACGGCCCAGTTCTGGATGACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18873
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
Genomic Location (Zv9):
Chromosome 7 (position 34523342)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32917682
GRCz11 7 33188832
KASP Assay ID:
554-6136.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGAGTGTAAAAGCCTGTGAGGTTTCTCATATTGTTGTCATGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGATAACTCCAATGAAATTTTCTAC
Long Flanking Sequence:
TCGGTGCTGTTGGATCACGTACGAATCATACTGGAGGTTACTAGGTAGGACACACAAAGTCAATTGTGCTCAGTCTAAGAAAGTATCATTGCATTATTTTTAAGATGTGTCAAATGTAACATTAGAATGCAATTTAGCATATGAAACGCAAAATCGCAGTTAAGATTTTTACTTTGAAATGTGTGCTTTAAAGCTTTTGATTCTGTACTATTCCCTGCATTCAGTTTTCCTTTAAAACGTTTAGTTGCTCAAAAACCATGTAACTTTCATCCAGTGCATCACAAAATAAAATGAACGCATGCATGACTACTAAATGGCTGCACTCAGAGGGAAATCTACTCAATGTGGCCTAGAAAATTGCATGATGGTCTGAAAAGTTGGATCCTGAACACTGACGATGCCTGAGCTGGAATGTTCTTCTACTAGGCCAAGTGTCACAGGGAATTACAGGGTGAGTGTAAAAGCCTGTGAGGTTTCTCATATTGTTGTCATGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGATAACTCCAATGAAATTTTCTACAATCTGAAGTATGAGGCTGATTTGCTCTTTACAAGGTGAGCTACAGTATACATGTAATTGCTGACGATAGATGGTGGTTGTGTGAATTACGGTAATTACAACATATTTTAATTCCCCCAGGGATTTTTACCCGACCCGATATGAGCTTAAACCTGACCTCTCTCTAGAGAAAGCAGATGATTTCAACCCCCCATTCAACTTTACCTTTCAGGTGAGGTACTATTCCCTGCTATCATGAGCTAAAGTGAGAATAAGCTAATATAAATGTTTCCTCTATTCAACACAGATCCAGAACCTTGGTTATTTTCCAATTCAAGATTTGCAACTCTACATTGCAATCCCTGAGGTCACAAAAAATGGGAATCAACTCCTGCAGATCAGAGATTTCCATATTGACCAGGTGAGCAGGATCCTTTCCCTCAAAATGTTTATTCTTTAGCCCAAAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9327
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
ENSDART00000052389 Essential Splice Site 972 1228 23 30
ENSDART00000127081 Essential Splice Site 934 1190 23 30
Genomic Location (Zv9):
Chromosome 7 (position 34523342)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32917682
GRCz11 7 33188832
KASP Assay ID:
554-6136.1 (used for ordering genotyping assays)
KASP Sequence:
GGTGAGTGYAAAAGCCTGTGAGGTTTCTCATRTTGTTGTCRTGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGAYAACTCCAATGAAATTTTCTAC
Long Flanking Sequence:
TCGGTGCTGTTGGATCACGTACGAATCATACTGGAGGTTACTAGGTAGGACACACAAAGTCAATTGTGCTCAGTCTAAGAAAGTATCATTGCATTATTTTTAAGATGTGTCAAATGTAACATTAGAATGCAATTTAGCATATGAAACGCAAAATCGCAGTTAAGATTTTTACTTTGAAATGTGTGCTTTAAAGCTTTTGATTCTGTACTATTCCCTGCATTCAGTTTTCCTTTAAAACGTTTAGTTGCTCAAAAACCATGTAACTTTCATCCAGTGCATCACAAAATAAAATGAACGCATGCATGACTACTAAATGGCTGCACTCAGAGGGAAATCTACTCAATGTGGCCTAGAAAATTGCATGATGGTCTGAAAAGTTGGATCCTGAACACTGACGATGCCTGAGCTGGAATGTTCTTCTACTAGGCCAAGTGTCACAGGGAATTACAGGGTGAGTGTAAAAGCCTGTGAGGTTTCTCATATTGTTGTCATGTGTCTGC[A/C]GTGAAGGAGAAGAAGTCATCCTCTATGATAACTCCAATGAAATTTTCTACAATCTGAAGTATGAGGCTGATTTGCTCTTTACAAGGTGAGCTACAGTATACATGTAATTGCTGACGATAGATGGTGGTTGTGTGAATTACGGTAATTACAACATATTTTAATTCCCCCAGGGATTTTTACCCGACCCGATATGAGCTTAAACCTGACCTCTCTCTAGAGAAAGCAGATGATTTCAACCCCCCATTCAACTTTACCTTTCAGGTGAGGTACTATTCCCTGCTATCATGAGCTAAAGTGAGAATAAGCTAATATAAATGTTTCCTCTATTCAACACAGATCCAGAACCTTGGTTATTTTCCAATTCAAGATTTGCAACTCTACATTGCAATCCCTGAGGTCACAAAAAATGGGAATCAACTCCTGCAGATCAGAGATTTCCATATTGACCAGGTGAGCAGGATCCTTTCCCTCAAAATGTTTATTCTTTAGCCCAAAGATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8272
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052389 Essential Splice Site 1133 1228 27 30
ENSDART00000127081 Essential Splice Site 1095 1190 27 30
Genomic Location (Zv9):
Chromosome 7 (position 34519983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32914323
GRCz11 7 33185473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTCAGCGTGAAGATCGGCGGATCCCTCCGTACTGATGCACTGCATGCGG[T/G]GAGCAGCTWTGACACTGAAATAACAGTCTGATRTAGATGAAGTAGTGCAR
Long Flanking Sequence:
CCAACTGGGCAGATTGAGCGTTCGCGAAAGTGATTTCTTCCCTCTTTTAGCCAAACTATCCCTTTAAGGGGCTTTACAGTTTGCCTGATTAGGGGCTTTTAGACTTGTTGATTTAATTCACAACCATAAAGCACCTCTCTGCAAAATAGCTGGTTTATACTGCCTGAATAAAGCCACTTTAGTGTAATAATTTGTGCCATAAATAAAGCTGAATATTTGGGGTTAGTAGTTCCTCTACGTTCTAGATATGTTATTGTGTTTTTGAAGATAGTCATATGTCTGAGGTGAGGAATTTTGTAATCTATGTCAGATTCCCACCACAAGCAGCTGGGTTTCATTAGTAAGGTAATTTGTTTTAGAGCTAAATGTTGCTTGTTTCTATGCACAGAACTACTCAAACACCCTGGCAGTGCCAGTGCAATGCACCGTCAATCTGCCTTCCTACAGAGACGTCAGCGTGAAGATCGGCGGATCCCTCCGTACTGATGCACTGCATGCGG[T/G]GAGCAGCTATGACACTGAAATAACAGTCTGATGTAGATGAAGTAGTGCAGTGTGGGAAGAGTTTGACATCAGAGCACAGTGTTCACACACAGCATGAAGGCTTTGCTCAAGAGGAGGATCTTCATAAACCAACGCTAAACTCTGACTAGAGCAGTAATTAGAGAGAAGATGTTAAATGGTTCATGCAGGGATACGGTTACTAAATCTGGTTCAGCTAAAAGTTATGTTTTCATTCCCCTTTGTCTTTCAAAAACAAAAAAAGCAGATGCTTTCAATTTACAGTGACACAGAAAATATATTTAGAAAAATATTTGAATATTAAATTGTTCCACACCAAAATACCTAAAATCAGTTTGACTCAGAACATCAGTTTGTTAAAAGATCAGTTTGTTCAGAAAACTTACATTTGCACTGAGATTATTATTATTATTAGACTGCAGATTTTACTTGAATATATAGTATTTTGTATCTAATGCAAAAGAAAATAAGGAAATACTTGT
Associated Phenotype:
Not determined