Busch Lab

ZMP

si:ch211-95i5.2

Ensembl ID:
ENSDARG00000035994
ZFIN ID:
ZDB-GENE-060503-893
Description:
Novel protein similar to vertebrate regulating synaptic membrane exocytosis protein family [Source:U
Human Orthologue:
RIMS2
Human Description:
regulating synaptic membrane exocytosis 2 [Source:HGNC Symbol;Acc:17283]
Mouse Orthologue:
Rims2
Mouse Description:
regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39240 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23489 Nonsense Available for shipment Available now
sa36810 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39240
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052257 Essential Splice Site 109 493 2 14
ENSDART00000133016 None None 277 None 7
ENSDART00000140093 None None 662 None 15
ENSDART00000145619 None None 150 None 5
Genomic Location (Zv9):
Chromosome 19 (position 17480298)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13176455
GRCz11 19 13094931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCAGAGGCGCCTCCTACACGGAGAAAGTCCAACACGCAGGTTACAGA[G/T]TATGTATAGAAAACACACCCATACAAATTAATTAATAATAATGAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23489
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052257 Nonsense 376 493 12 14
ENSDART00000133016 Nonsense 160 277 5 7
ENSDART00000140093 Nonsense 545 662 13 15
ENSDART00000145619 Nonsense 33 150 3 5
Genomic Location (Zv9):
Chromosome 19 (position 17389947)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13266716
GRCz11 19 13185182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTGAAGTTATTCGGGCTCGAGGTCTGGTGGGCAAACCAGGAAACAAA[C/T]AGACTCCAGGTAGGCTTTATTATTCAGTCTGATTGTGACCATGCCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36810
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052257 Nonsense 381 493 13 14
ENSDART00000133016 Nonsense 165 277 6 7
ENSDART00000140093 Nonsense 550 662 14 15
ENSDART00000145619 Nonsense 38 150 4 5
Genomic Location (Zv9):
Chromosome 19 (position 17389808)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 13266855
GRCz11 19 13185321
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTAATGTTTATACTACAATTTCTGTGGTCCCTCATTTACAGCACCTTA[T/A]GTAAAAGTATATCTACTGGATAATGGGAAGTGCGTCAACAAAAAGAAAAC
Associated Phenotype:
Not determined