Busch Lab

ZMP

ptpn2b

Ensembl ID:
ENSDARG00000035986
ZFIN ID:
ZDB-GENE-030909-8
Description:
tyrosine-protein phosphatase non-receptor type 2 [Source:RefSeq peptide;Acc:NP_997819]
Human Orthologue:
PTPN2
Human Description:
protein tyrosine phosphatase, non-receptor type 2 [Source:HGNC Symbol;Acc:9650]
Mouse Orthologue:
Ptpn2
Mouse Description:
protein tyrosine phosphatase, non-receptor type 2 Gene [Source:MGI Symbol;Acc:MGI:97806]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32239 Missense Available for shipment Available now
sa8418 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32239
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052239 Missense 47 393 2 10
ENSDART00000125910 Missense 47 360 2 10
Genomic Location (Zv9):
Chromosome 19 (position 13013337)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12471683
GRCz11 19 12391211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAGTGGCCAAGTATCCAGAGAATCGCATTCGAAACCGATACAGAGAC[G/A]TGAGTCCATGTAAGTAGCCTCAGATTTGAGTTTATATTTTGTTATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052239 Nonsense 278 393 7 10
ENSDART00000125910 Nonsense 245 360 7 10
Genomic Location (Zv9):
Chromosome 19 (position 13005644)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12463990
GRCz11 19 12383518
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGATCAGCTGCGTTTYTCATATATGGCTGTGCTGGAGGGTKCCAAGTA[C/A]ATTATGGGAGACTCGTCTGTGCAGGCATGTGATCTAGACAGTWTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4797
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052239 Essential Splice Site 352 393 8 10
ENSDART00000125910 Essential Splice Site 319 360 8 10
Genomic Location (Zv9):
Chromosome 19 (position 13005319)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12463665
GRCz11 19 12383193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGKSCCAGAGGCCCCCAATAAAGAACCAGACAGGGATGCTGGAACACAG[T/A]ATGTAAAAAAAGACTTTTTATGTTTCTTAGACTTGTTCCAAAACTTGAAT
Associated Phenotype:
Not determined