Busch Lab

ZMP

ube3c

Ensembl ID:
ENSDARG00000035978
ZFIN ID:
ZDB-GENE-040426-1211
Description:
ubiquitin-protein ligase E3C [Source:RefSeq peptide;Acc:NP_956767]
Human Orthologue:
UBE3C
Human Description:
ubiquitin protein ligase E3C [Source:HGNC Symbol;Acc:16803]
Mouse Orthologue:
Ube3c
Mouse Description:
ubiquitin protein ligase E3C Gene [Source:MGI Symbol;Acc:MGI:2140998]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16030 Nonsense Available for shipment Available now
sa34139 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27011
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228 Essential Splice Site 114 995 5 25
ENSDART00000125313 Essential Splice Site 114 1081 4 23
ENSDART00000134547 Essential Splice Site 114 1081 5 24
Genomic Location (Zv9):
Chromosome 7 (position 42020565)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40356875
GRCz11 7 40627892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCCAGCTTCTCTTTTTTTACAGACTAAGTGAAGACAGACCAAGAATGG[T/C]AAGGACCACAAAAATGTTCTGTGCTGCCCCGTTAATTATCGCTCAATTCA
Long Flanking Sequence:
AGTGACATTTATGCATTCTGGACTGTACCAATATGTACACTGTATATAAATAGTCACAGAAAGATTTGAGGATCTGAACAAATAGATTTACTACATGTTTTTTTAAATGAAAACTTCACATTTGTGTGTTTTTTTTTTGTTCCTGCAGGATGAGAGGAAAAGATTGAAAAATGCAATCATCATTCAGTCTTACATAAGGGGATACCAAGACAGGAAACAGCAAGTATGTGGAAGTACTCTAAACTCAAGTTCCGAGAAGCTTCTTTCAAAAAAAAAAAAAAACCGTCTGTATACATGTAGAGGTCAGACAGATAGTTACATTTCTACGTTTTCTGTTCTTTTATTTAAATAGTATGCCATTCAGAGGGGCTCCTTTGACCACTGTGTGTGTCAGTGCCAGTCAGGCTCTGGCCCTCAGCTTACAGACAGTGCCATACTCAGCCAACTGGTTCGCCAGCTTCTCTTTTTTTACAGACTAAGTGAAGACAGACCAAGAATGG[T/C]AAGGACCACAAAAATGTTCTGTGCTGCCCCGTTAATTATCGCTCAATTCAGTTTTTTGTTTACACTTTCCTATTAGTGTTGATTAATGAAAATTATGAATCTGAAAATTTCATTGTATAACTGTGCATTTGAAGATGTTTATTTCTTAACCTTTGTAGATCTGGATGTGTCAGTGTTTAGTAAAGCATCATGCTCAGTTTGTCAAGCTGCTGACGGGGCCAGAAAGACAGATCTGTCTGTTTCAGATCAAGAGGTTACTGGGACACTGTTGCAGGTACAAAATTAGATGTTTACTTCGCATTTCCAAAATGTATCCACCTGTCATAACTCTTTATGGCTGGGACACACCAAACTATTGGGCCATTGGTCATGAGCACGAACGAATTCCTCCGTGGTGATTGACAATTAGTGTAGTAATGCTACAGATATGTCCTTTCATGCAGGTGCAGAACGCTCTCTCTTGTTTCAGTGGACTGCCATCCATTTGGTGTTTTACTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2387
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228 Nonsense 397 995 11 25
ENSDART00000125313 Nonsense 397 1081 10 23
ENSDART00000134547 Nonsense 397 1081 11 24
Genomic Location (Zv9):
Chromosome 7 (position 42016917)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40353227
GRCz11 7 40624244
KASP Assay ID:
554-3411.1 (used for ordering genotyping assays)
KASP Sequence:
NAAAGGATGGCAGTTGGATATCTGTGCATTACATAACGGAGGAATGTGTA[C/T]AGAAGTTGGACACCAAGCAGCAGACTAATGCTCTGTTAACATTAGTGTGG
Long Flanking Sequence:
CTTTCCCATTTCAAAACTTCCTTTGGTCCCTCCAGGCCACCATAGCCTCTTCTGTGCAGGCCAGAACTCAGGCTCCCTGGCTCTTTTACTTTGTGCTCTCAGTCGGAGAATCAGGACTGAGTAAGTAGTGTATGGAAGGGAGAATTAAAACAGCATTGAATAACTAATATAATCACTTACCCCCCATTTAAAGTCAGGTTTGAGGATTGTGTGTTGTGCTTCCGTAGGTTCACTCTCAGAGGAAGGGTTGCTGTTATACCTGAATGCTCTACAGACGCTTTTGCCTTTGTTGCCAGTGACAGAGTGTAACAGTAGAGCTGACATCAACAGTGATTCAGAAGATGAGGAGGAAATGACCGTACAGCATCCTGCAGCACCGGTACATGCGCGTTCTCGCTTATTCACATCTTTACAGCATAGTTTACATTTTGATCAATTGTGTCATTTTTTTAAAGGATGGCAGTTGGATATCTGTGCATTACATAACGGAGGAATGTGTA[C/T]AGAAGTTGGACACCAAGCAGCAGACTAATGCTCTGTTAACATTAGTGTGGAGAGACTCAGCAAGTGAAGATGTCTTCACCATGATGGCCTCCATCTGTCACACGTTGATGGTGCAACACCGTATGATGGTGCCACGAGTCAGGTCAGATACACAATACACTAAAACCTAGTAAATTAACCTCACAGTCATCATCACATCGAGGGCGATGAATCAAAGGCAATTTTTATTTTGTTGGTAAAGCCAGTTCTAGTAAGCCTCCAGCATGAGGTGTCAGATGGAGGAGATTTTACTACACGGAGTTGTAGTTCACTGACAAGCTACGCAAAAACAATTTAATTGGATATGACATTGCAATAATAGTTCTGTCATAGTTACAGCTGTTATTGTTAGGGTTGTCAAAAGTATTGACTTCAGCACCAATGAATAATGATTTTTTTTTCTTTTTACGCCCTGTTGAGGAAGTTCTTAAACACTGTGTTAAAATGCTCAACAGATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228 Nonsense 929 995 21 25
ENSDART00000125313 Nonsense 929 1081 20 23
ENSDART00000134547 Nonsense 929 1081 21 24
Genomic Location (Zv9):
Chromosome 7 (position 41987615)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40323925
GRCz11 7 40594942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAACAGGATAGCCTACATCCATTTAGTGGCCGAKTACCGTCTRAACAAA[C/T]AGATCAGAGCACATTGCCTGGCCTTTCGACAGGGTCTGGCCAACGTGGTC
Long Flanking Sequence:
TGTTTAGCAAATGAAGAACTTTTGGGAAAACGTAGACAAATAAGGAACAAAATGTGAATTTATTTATTTATTTATTTTTTTCTCCATAAGCACACTTTAAAGATATATCACTCTCTTGGGGGCAGCATGCATGTTATAAAAATGTCTGTAACATTGTTTTAAGATAAAATGGCAAAAATGTCTCTTTAATTAAAAATGTGCAATAATTCTGCAGTAACAGTAAAAGCAGACTGCTATTTACTTTCCGCTTCATTAATGCAGTAAACGGTGGCCATGTGCACTCATTTCCTCTGTGTTCCTCAATTGCCTTCGACACTTTCCTCTGCAGATGCCCTGTTCCACTCAGTCACTGAGCGCAGGGAGACGGTCCCTGTCACACACTCATCTATTTTTGTCTTTTCCAGGTGGTCGAGCTCAAACCAGGGGGAAAGGACATCCCGGTAACCACAGCCAACAGGATAGCCTACATCCATTTAGTGGCCGATTACCGTCTGAACAAA[C/T]AGATCAGAGCACATTGCCTGGCCTTTCGACAGGGTCTGGCCAACGTGGTCAACCTGGAGTGGCTGCGAATGTTTGATCAGCAGGAAATCCAGGTGAAACTGTCAGCAAAAGTGTCTGAACACAAAACAGTCAGAGTGGATTCATAATTATAACAATGACTTCAGCAGATATTATCTGTTTGTAAGTTTTAATCATAAAATAAATGAAGGATTTTTGTCTATTTCCAGGTATTGGTTTCTGGTGCACATGTGCCCATCTGTTTGGAAGACCTGAAGAGATTTACTAACTACTCGGGTACAAGTCCAAGATTTTGTTACTATGGGGGAGCTGGAAAGATGATGGTGATGGTTAGATGGGAGATGCTTATCATTGGAAAACCTATAATGCGATCTTGGCCACGTGAAACATGTCTTAGCTAATCAAATGACTGCTTCCCCTTTCCTTTGTATTGCCATAAAGGCAGCATTAGCTGTTATGCTTTTTAGGATAATGATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34139
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052228 None None 995 23 25
ENSDART00000125313 Nonsense 1018 1081 22 23
ENSDART00000134547 Nonsense 1018 1081 23 24
Genomic Location (Zv9):
Chromosome 7 (position 41985978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40322288
GRCz11 7 40593305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCGATGAGGAGAAACGCAAGCTGCTCAAGTTTGTCACAAGCTGCTCA[C/T]GACCTCCGCTCTTGGGCTTTAAGGTTAGTGACTTTGGCAAAAACCATGTC
Long Flanking Sequence:
GCTCAATAGTTTTAAGAGTTTTAAAGAGTTTTAAGTGTAGATGTTAGTATTTCAAAACATTGGTGTTTTAACACTTTATAAATAAATGGTTTAATATATAAATACATGAATGTACCATTGTTTCAGAGTTTTTTTACAGTTACTATTTAACAGTAAATATTAAAATGGACTACATTATAATTTTTTTTTTTTTTACAGATTTTGACAGAAAAAAAAACAATTTTACAGATTTTTTTTCTTTTTCTTTACAATATGTCAATTTTTTTTATCATGTTTAGCAGTAGCAGCACATAGCTGAAATGCTGTATCCTCTGATCATTGAGAAGTGTTAGTTATGCTAGACTAAAGAGTTCTATTTCTAACTTTGTTTTCCTCGTTTGTTACTCTGCCTAGGTGGTTATTCGGCAACTCATCCAGTCATCAAAATCTTCTGGGATGTAGTGGAGAGCTTCAGCGATGAGGAGAAACGCAAGCTGCTCAAGTTTGTCACAAGCTGCTCA[C/T]GACCTCCGCTCTTGGGCTTTAAGGTTAGTGACTTTGGCAAAAACCATGTCATAACACGCGACAATATTCCAGAGAAAAGCAATTTGGCGGTCTGCACTAAATGCAATGCGACACAACAGAAGCATTTAAATACCAGCCATTTATTTATATATCAGCCAATGCACTGCCAACGAAATGGTAAGTGTTTTAATCTAATTAATACATAATTAACCTATTTGACATTATTAAATGTACATGGGCTGAGTGACTAATGTGGTTTGCAGTCACAGTTCTGACTTTCCTTTTCAAACCATTTGCTAGTTGTGTTATTTTTATGATCTGAAGTGAACTATTTGCTGCTGCTTTCAGTAGTTTGGCAGTAAATGTCACATAATGGTACTCAAATTGGTAGCATTTAACACTGAATAAAGCACATAATCTGTATCTGAGGTGAGAATTTAAGTAGTTTATCCTGTTGTTTTGTTGTGGAAATATAAGTTTCTAAAATAGAAATTTAGTGT
Associated Phenotype:
Not determined