Busch Lab

ZMP

ptprn2

Ensembl ID:
ENSDARG00000035970
ZFIN ID:
ZDB-GENE-030131-3758
Description:
Protein tyrosine phosphatase, receptor type, N polypeptide 2 [Source:UniProtKB/TrEMBL;Acc:A3KPJ3]
Human Orthologue:
PTPRN2
Human Description:
protein tyrosine phosphatase, receptor type, N polypeptide 2 [Source:HGNC Symbol;Acc:9677]
Mouse Orthologue:
Ptprn2
Mouse Description:
protein tyrosine phosphatase, receptor type, N polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:107418]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa18156 Essential Splice Site Available for shipment Available now
sa34136 Nonsense Available for shipment Available now
sa15841 Essential Splice Site Available for shipment Available now
sa34137 Nonsense Mutation detected in F1 DNA Not yet available
sa11255 Essential Splice Site Available for shipment Available now
sa15163 Nonsense Available for shipment Available now
sa30890 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18156
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 None None 650 None 16
ENSDART00000099049 Essential Splice Site 46 1027 None 23
ENSDART00000142195 None 46 287 2 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41659218)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39995528
GRCz11 7 40266545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTGTCTGTTTGAAGATGTGTGTAAACTGAATGAAGTCTGCATCAATGG[T/C]GAGTTGTTCAAAGATTTCATTAAAATCANAACGTTGACTAGTACTACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34136
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 None None 650 None 16
ENSDART00000099049 Nonsense 141 1027 5 23
ENSDART00000142195 Nonsense 161 287 5 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41708384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40044694
GRCz11 7 40315711
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGAAGGCTCAGAAAGAAGCAGCGAGCAGGACATTGCAAAGGTTCCTT[C/T]AAGGTTTCCTGCCTTCTGATGTTTCCTCCTTCAAACAGAGTCCTCAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15841
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 147 650 2 16
ENSDART00000099049 Essential Splice Site 524 1027 9 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41714146)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40050456
GRCz11 7 40321473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTATTCAAGTCCACACGAYGGAGACTTTGGCTATATTATTACTGAAGA[G/T]TAAGTATRAAGAAAAATATTCAGATCACATRTMATTAGCAACAAAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34137
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 174 650 3 16
ENSDART00000099049 Nonsense 551 1027 10 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41721334)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40057644
GRCz11 7 40328661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGGAGATCTTAGCTGAGCGAGTCAGGCTTCATGTAACAGATTTCCTA[C/T]AGCTCTCGTAAGTACACACACACACACACACACACGCACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 225 650 6 16
ENSDART00000099049 Essential Splice Site 602 1027 13 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41852907)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40189217
GRCz11 7 40460234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAATGTTTATCAGAGTNNNNNTCTCTCTCTCTTGTCTGTTTTAATTAC[A/T]GAGGGGCAAACTAAACCACATYCCCCTGGTCAAACAGAGTCARGTGGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5437
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 296 650 6 16
ENSDART00000099049 Essential Splice Site 673 1027 13 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41853125)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40189435
GRCz11 7 40460452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGCCGGTTTAGGAAACGACACAGGCCACGATGCCACAGCAGCCTATCAG[G/A]TACGAGCAGGCCCATGATTTCCACCAATCACGCTTCATTTGTACATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15163
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 432 650 9 16
ENSDART00000099049 Nonsense 809 1027 16 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41866438)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40202748
GRCz11 7 40473765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATAGATGATCACTCTAGATKCATCCTGAAGCTGGAGAATAACCAATCC[A/T]GATCWGATTACATCAACGCAAGTCCTATAGTAAGTAKTTAMAGTAATTCS
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27010
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Essential Splice Site 581 650 14 16
ENSDART00000099049 Essential Splice Site 958 1027 21 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41883154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40219464
GRCz11 7 40490481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTCTGCTCTTTTCTCAGAAGCGATAACGAGTTTCTGTCTTCATTTGC[A/T]GCGATGGTGCCGGAAGGAGTGGAACCTACATCCTGATTGACATGGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30890
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052222 Nonsense 631 650 16 16
ENSDART00000099049 Nonsense 1008 1027 23 23
ENSDART00000142195 None None 287 None 6

The following transcripts of ENSDARG00000035970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 41891205)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 40227515
GRCz11 7 40498532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCTGCGTACCTGAGCTTCTTCTACTTTTCTGTCTTCAGGATCAATTT[G/T]AGTTCGCACTGACGGCTGTAGCAGAAGAGGTGAACGCCATCCTGAAAGCT
Associated Phenotype:
Not determined