Busch Lab

ZMP

acana

Ensembl ID:
ENSDARG00000035891
ZFIN ID:
ZDB-GENE-050208-221
Description:
Aggrecan [Source:UniProtKB/TrEMBL;Acc:Q75ZI2]
Human Orthologue:
ACAN
Human Description:
aggrecan [Source:HGNC Symbol;Acc:319]
Mouse Orthologue:
Acan
Mouse Description:
aggrecan Gene [Source:MGI Symbol;Acc:MGI:99602]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40999 Nonsense Mutation detected in F1 DNA Not yet available
sa7281 Nonsense Mutation detected in F1 DNA Not yet available
sa31591 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27038
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690 None None 308 None 8
ENSDART00000005288 None None 287 None 7
ENSDART00000017467 Nonsense 705 1831 13 28
ENSDART00000132881 None None 169 None 3
ENSDART00000147879 None None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50233044)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48503280
GRCz11 7 48776056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGAAATGTGTTCATGAAGAAGTGTTCATGTAAATGATTATGTTTG[G/A]TTAGTGTTTATACAAAATATGATGGTAACATTTTAGTTAAGGTTACAATT
Long Flanking Sequence:
AGGGTGGGCAGATAAATCAACATCCATTTTGGGAGGGAAAACAAAACAGAAAATTATACATAAAGAATTTTTTCCCTTAAACATTTCACCTTTCACTGGAATAACAGAAGCACACTGAATCGCTCAAATGTTCCATTTTCAGGTCAAGTTTTCCATGCAAGTTCTTTCGAGGGATTCACGTACGGTGAGGCAGTGGCTCACTGCCAGGGCCAAAATGCTTCTCTGGCCTCCACAGCACACCTGTATGCAGCTTGGAAGCAAGGCTTTGATAAGTGTCGAGCTGGCTGGCTTCTTGACCGCAGTGTGCGTTACTCCATCAATATCCCCCGGCAGCAGTGTGGTGGAGGGAGGACTGGAGTTCACACAGTTTACTTGTTTCCCAACCAAACCGGCTCTCCTGACCTGCACTCCAAATTCGATGCATATTGCTTCAAGGGTAAATATAACTTCTGTTTTGAAATGTGTTCATGAAGAAGTGTTCATGTAAATGATTATGTTTG[G/A]TTAGTGTTTATACAAAATATGATGGTAACATTTTAGTTAAGGTTACAATTCATGCGATTTACTACTAGCTTATTACCTGCCTATTATTAAGATGTTAACTGTTCATCAGTAGTTATAAAGTACTGTTTAAAGTATAATAAGATCTTATTCTACAAGCCAAATTTTACCCAAAACCTAAACCTAACTTCTACTTTACTAACTATTTATTGACCTTATTCTAAAATGCGGAAGTGCGCCTGTTTTCGCGATTGTCTTAGAACTTCCGATTCAGTCGCCTATGGGAGAAATGACTAGGAATAATAAACGGCAGAAAGCGGTCAAACTACTTGCTCTACAAACAAATGTTTGCATGACTATACAGACCAAGTAGAATAATATAACAAGAAAATATCAAATTGCAACATCAAGCAGCGTAATGAGCTATTTTTAATGTCTAAAAATGAATGGAAGTGAATGAGACCGGAAGTCTCGAGCCAAAAAGATTCAAATGGCAGCGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40999
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690 None None 308 None 8
ENSDART00000005288 None None 287 None 7
ENSDART00000017467 Nonsense 717 1831 14 28
ENSDART00000132881 None None 169 None 3
ENSDART00000147879 None None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50234011)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48504247
GRCz11 7 48777023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATAAAGTGTTACCAATATGATTTATAAAATAATTCATTAAATATTTGT[C/A]ATTTTTATATATAGAGGATCTGGATCTTCCCCTGAATGAAAGTGAATCGC
Long Flanking Sequence:
TCTCGAGCCAAAAAGATTCAAATGGCAGCGCCCGCTCGTCGGCGGAGAATAAGGTCAATAAGCAGCTAATTAGTAGTTTATTAAGCTTACTGATTTGTTTATACAGTGGCATTGTGGCTCAGTGGTTAGCACTGCCGCCTCACAGCAAGAACTTCACTGGTTCGAGTCCCAGCTGGGACGGTTTGCATGTTCTCCCCGTGTTTGCGTGGGTTTTCTCCGGGTGTTCCGGTTTCCCCCACAGTCCAAAGACATGTGGTATATGTGAATTGGATGAACTGTTTGAGAGAGTGTGGATGTTTCCCAGTTCTGAGTTGTGGCTGAAAGGGCATCCACTGTGTAAAACATATGCCGGAATAGTTGGAGGTTCATTCCACTGTAGTGACCTCTGATAAATAAGGGACTGAGCTGACGTAAATTGAATGATTTATTAAAACAGTGAAATGTGACTTAAAATAAAGTGTTACCAATATGATTTATAAAATAATTCATTAAATATTTGT[C/A]ATTTTTATATATAGAGGATCTGGATCTTCCCCTGAATGAAAGTGAATCGCAAGAGACAGTGACGGAGGAAAAGATAGTGAGCATTTCATCCCATCCTGCTCTTCACAGACCTGGTAATATGTCTTAGGATACATACATGAGTCAGTGCCAGATAAATAAATATTTTTGAGGTAAGCATAAATCAGCTGATTCGAATGTTATCACTCAATTGAATGGGCATTATCAGTGGTTTTCACCAGATAGATATGGGCCAGTATGGGCCTTCTGCGCCTACTAGTAGGCTATAATCATCCAGCCACCTGGTTAATCAGCTATAGATCACATACGACTGCGGCCGAAAGTTTTTAAAGTTTTCAAGATTTATTATATTATTTATTAAATTTCTCATAAATTGTATTTTATTAACGTCTACCCCTACCCCAACCCTAAACCTAACCGTCACATTAATGTAAAAACATCTGGAGTCTTTTCTATTGGTATTGCAGCATTCTGAGCCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7281
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690 None None 308 None 8
ENSDART00000005288 None None 287 None 7
ENSDART00000017467 Nonsense 1241 1831 18 28
ENSDART00000132881 None None 169 None 3
ENSDART00000147879 None None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50236983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48507219
GRCz11 7 48779995
KASP Assay ID:
554-4482.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTAGTAGTGATGTCATCTTCTTCAGCAATAATGACMTGGTGGAAATGT[C/A]AAAMAAGCCACTTCAAGGAMTGGAATTAGGAAGAGGGGAAGTGGAATATA
Long Flanking Sequence:
GATATCTTCATTTTTAACAGAACAAGAGCTGGGTAGTGGTCAAGTCGATTTCAGTGGATCAGGACTTTTCTCAGGGTCTGGGGTGAGTGGTGATATCTCTGGCTTAAGTGGTGAAATCTCTGGATCGAGTGGTGATAGTTCAGGTATAAGTAGTGACATTTCAGGAATGAGTGGTGATATCTCAGGAATGAGTGGTGATATCTCAGGAATAAGTGGTGATATTACAGGAATGAGTGGTGATCTCTCTGGTATGAGTAGCAGTGACCACAGTGGCTCAGGGAGTGGTTTAGCATTTTCTGGGGTGACATTTTTGGGGTCAGGCTTCACTGATCTCACAGAACAATCTCGTGAACAGGAAGCTTCTGGACTTGTGTTCTTTGGGTCTGGTGAGGGAAGTGGATTTAGATCTGGAGGCTATGCAATTGAATCAGGGGAACGATCAGGGGACTCGGCTAGTAGTGATGTCATCTTCTTCAGCAATAATGACATGGTGGAAATGT[C/A]AAACAAGCCACTTCAAGGAATGGAATTAGGAAGAGGGGAAGTGGAATATAGTGGCACAGTCAGACTGTCCTCAGGGAGTGGAGATGACCAAAGTGTCTTTATAAGCGGGCATGAATGGATCCCAGTCACTGCTAATACACCATCTGTAAAATCCACTGATCCTCCCCCAGCTGAATTATTTGATCAAGGTCCATCAGACCTGTACAGTGATACTGCAGGACACCTAGGTCCTTATTTAAAACCAGAAGAGATCATCAACAATCTTGACGCTGTTCCTTTGGCAGCTTTGTCTTCTACTACAGAAACTGCCTCTTTACAGAGGCCTGCTGTCGTAGAACGACCTGCTGTGAATGGTGAGTTTTCTATTGCATATTATATAATTGAGATGTATGGCCTCTTTACTATATCATTTTTATGTTCTATTTTCTTTTTACCTAAACTACCATAATAGATTATCTTAACCCATGTGAACCAAACCCTTGTGGAGCTGGTGTGTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31591
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003690 None None 308 None 8
ENSDART00000005288 None None 287 None 7
ENSDART00000017467 Essential Splice Site 1539 1831 22 28
ENSDART00000132881 None None 169 None 3
ENSDART00000147879 None None 344 None 4
Genomic Location (Zv9):
Chromosome 7 (position 50238040)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 48508276
GRCz11 7 48781052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGTGTGAGTGCTGATCTGCACCTCTTAAGAGGCTTTCAAACTGATGCC[A/T]GATCAGCACTTCTACAGTAACCACAATTGACTCTAATCTCTCTATCAATG
Long Flanking Sequence:
GCCAGTTTGGTGAGTCGGACTGATTTAAAACATAAGTTATATCAAAGAGATTTATAAAGTCACATCAATTATGCTAATTTTTATAGTTTTTTTTTTTTATTAATTGTTTTATAGTCTGATATTTGTGGTAAATCTAATCAAATTGTTATCTCAATGTCTCTTGGTTGGCATTTCATTTGTGAATAACTTCACTTCTGTTCAGTTTGCTCATGCCTATGCCCTCACAGCTGATTTCACAGGTTATGTGGCATGTGTGTGGTTAAGTAATTGTACACTTTCTCAGCTCTTGTGTCCAGATGTCTTTTCAGTGACTGTTCACCTGTGTTGTTTTTGTTCAGCTGTGCCTTTGCTGCAGTCTGGTTTAATCAGCACGCCTGCTAACATCTGGTACATGCTCATACTTCTTGTCTATCTTCACATGAATCTGAACTCTGAAATTCTGCTTCTGGTACTGTGTGAGTGCTGATCTGCACCTCTTAAGAGGCTTTCAAACTGATGCC[A/T]GATCAGCACTTCTACAGTAACCACAATTGACTCTAATCTCTCTATCAATGTACCACAATTTCCTGAGCGTGACTCTCCTCAGCCTTTCAAAATATTGATGGTATAATTACTCAAGAGATTGGCTTACGGTGTAGAAGCAAGAGTTCTGATTCAATGATGCTCTCTGCTAAGCTTGACCTTCCTCGGGGCATCTTTATAGTTGGCAGCTTTAATTGCTAAACCTTTATTTGCAGAGGTTGATGTATGCCATTCAAACCCTTGCGCCAATGGAGCCACCTGTGTGGAGGTAGAGGACACTTTCAAATGCTTATGTCTGCCCAGCTACGAAGGAGACCGGTGTGAGACTGGTATGAGGCTGCTTCCGCTAATTCTACTAACAGTCTTTCAAAAACATCCTCTAGATGTCACTGTGGTGAATTCAGTGAAACTGTAAGGGTATATTTGTGTGGGTGGTGGGAAACTTTGATGTTTTTTTGGGGAAGTGTGTGTGGGGTCATTCC
Associated Phenotype:
Not determined