Busch Lab

ZMP

gata6

Ensembl ID:
ENSDARG00000035831
ZFIN IDs:
ZDB-GENE-000622-1, ZDB-GENE-000622-1
Description:
transcription factor GATA-6 [Source:RefSeq peptide;Acc:NP_571632]
Human Orthologue:
GATA6
Human Description:
GATA binding protein 6 [Source:HGNC Symbol;Acc:4174]
Mouse Orthologue:
Gata6
Mouse Description:
GATA binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:107516]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38164 Nonsense Mutation detected in F1 DNA Not yet available
sa38163 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051998 Nonsense 272 501 2 7
ENSDART00000051999 Nonsense 160 383 4 11
ENSDART00000077947 Nonsense 158 382 3 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 173762)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4367902
GRCz11 2 4208851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCGGCGTGGCCCGCGGGACCCTTCGAGAACTCCATGCTGCACTCACTG[C/T]AATCCCGAAGCGCACCGCTGGCCATCAGGGGCCCCAACGGAGGTGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38163
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051998 Essential Splice Site 412 501 5 7
ENSDART00000051999 Essential Splice Site 299 383 9 11
ENSDART00000077947 Essential Splice Site 298 382 6 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3540 (position 166241)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4375423
GRCz11 2 4216372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAAGGAAAAGAAAACCAAAGTCTTTGAGCAAAGTGAAAGGATCATCTG[G/T]TATGTTTAATAATGTTCATTTAAAAGCATTCCTTCATGTGTGGTCAAATG
Associated Phenotype:
Not determined