Busch Lab

ZMP

sirt3

Ensembl ID:
ENSDARG00000035819
ZFIN ID:
ZDB-GENE-070112-1762
Description:
sirtuin 3 [Source:RefSeq peptide;Acc:NP_001073643]
Human Orthologue:
SIRT3
Human Description:
sirtuin 3 [Source:HGNC Symbol;Acc:14931]
Mouse Orthologue:
Sirt3
Mouse Description:
sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21101
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051973 Nonsense 97 357 3 8
ENSDART00000147036 None None 252 3 8

The following transcripts of ENSDARG00000035819 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58749854)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57202463
GRCz11 7 57504903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACAATGTTCACCAGCAAACCCTTGAAGACATTGCAGAAAAAATCAGA[G/T]AACGCAAGTTTAAACGAATTGTGGTGATGGCAGGGGCAGGCATCAGCACA
Long Flanking Sequence:
TACTGAGTAGTTTTAAAGATGTGTACTTTTACTTTTTTTCTTAAGTAAATTTTTAGTGCTGAATTAGTACATTTACTTCACTACTTCCTTTAACCTGCAGTCACTACTTTATTTATTTTTTGTTTATGGGGATTAGAGAAATCTGTCCTGTGATTCTAACAAATTATTTTGGTGGTTTGGTTTACTTTTCCAAACTGCAGTATAACTCAAAAAACGGTTATCGTGCCATGCCTACTTTCAGTGCTTAATGACAAACAAACAAACACTATTTTGTAAGAAACCCTTTTTCTAGACTCATTAGTAAAATGTGTTGGAGTAGAAAGCTCTGGGATGTTGGTTTTCTAGGAACAGAAAACCTGTTCATTTGGAATGAATTTTGATAAAAATTTTGACTTTACAGAGCTGCCTTCATTAAATGTGGTGGAACAAGAGGCCTGTTTGGAGGAGGCCGTGACAATGTTCACCAGCAAACCCTTGAAGACATTGCAGAAAAAATCAGA[G/T]AACGCAAGTTTAAACGAATTGTGGTGATGGCAGGGGCAGGCATCAGCACACCAAGTGGAATCCCAGACTTCAGGTAAAGCAGAACTCAACACTCTCTTGTCCACAAATCCACCTTTGAGATCAGTGCAACTTAAATCTCTTTTCCCCCCACAGATCACCCGGCAGCGGCCTTTATGATAACCTTCAACAGTACAATCTACCCTATGCTGAAGCCATATTTGAAATAAATTATTTCCATCATAATCCTAACCCTTTTTTCGCTCTTGCCAAAGAGCTTTATCCTGGTAATTACCAACCCAACCTGACGCACTACTTCATTCGCATGCTTCACGATAAGGAACAGCTGCTCAGGATGTACACGCAAAACATTGATGGACTTGAGCGCAGTAAGTATATTTTAGTTTAGATCACACCATGTACTCTACACTCTTTCCACCAAGTCTTTAAAGCATAGGTATTAAACTCATTTCCTGGAGGGCAGCAGCACTGCACAATTTTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27071
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051973 Nonsense 168 357 4 8
ENSDART00000147036 Nonsense 63 252 4 8

The following transcripts of ENSDARG00000035819 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 58749561)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57202170
GRCz11 7 57504610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCTAACCCTTTTTTCGCTCTTGCCAAAGAGCTTTATCCTGGTAATTAC[C/T]AACCCAACCTGACGCACTACTTCATTCGCATGCTTCACGATAAGGAACAG
Long Flanking Sequence:
CTCATTAGTAAAATGTGTTGGAGTAGAAAGCTCTGGGATGTTGGTTTTCTAGGAACAGAAAACCTGTTCATTTGGAATGAATTTTGATAAAAATTTTGACTTTACAGAGCTGCCTTCATTAAATGTGGTGGAACAAGAGGCCTGTTTGGAGGAGGCCGTGACAATGTTCACCAGCAAACCCTTGAAGACATTGCAGAAAAAATCAGAGAACGCAAGTTTAAACGAATTGTGGTGATGGCAGGGGCAGGCATCAGCACACCAAGTGGAATCCCAGACTTCAGGTAAAGCAGAACTCAACACTCTCTTGTCCACAAATCCACCTTTGAGATCAGTGCAACTTAAATCTCTTTTCCCCCCACAGATCACCCGGCAGCGGCCTTTATGATAACCTTCAACAGTACAATCTACCCTATGCTGAAGCCATATTTGAAATAAATTATTTCCATCATAATCCTAACCCTTTTTTCGCTCTTGCCAAAGAGCTTTATCCTGGTAATTAC[C/T]AACCCAACCTGACGCACTACTTCATTCGCATGCTTCACGATAAGGAACAGCTGCTCAGGATGTACACGCAAAACATTGATGGACTTGAGCGCAGTAAGTATATTTTAGTTTAGATCACACCATGTACTCTACACTCTTTCCACCAAGTCTTTAAAGCATAGGTATTAAACTCATTTCCTGGAGGGCAGCAGCACTGCACAATTTTGCTCCAACTAATCAAGGTAGTGCTTCCTAGAGGTGTGAAATAAACTTGCGGTGGCAGTCAGATTGAAACACACCTTTTAACTACGGCACATGGTTACGTAATTGTGACCAAAAAGTGATTTTTAACAATATTTACATTTCTTATACACTGTTTCTTTTCAATGGGTTGATTTTTTTAAAGACTCTATTTGTTTTACTTTTATTCTTTTCAGGAGCCACGTGCACACACTGACAGGTAAAGAGTGCTTCTGACATTTTGTCTCATCAAATTAAAAATATATATACAGCAAATGAGA
Associated Phenotype:
Not determined