Busch Lab

ZMP

si:ch211-246f9.1

Ensembl ID:
ENSDARG00000035655
ZFIN ID:
ZDB-GENE-060503-223
Description:
RAD21 homolog [Source:RefSeq peptide;Acc:NP_001038585]
Human Orthologue:
RAD21
Human Description:
RAD21 homolog (S. pombe) [Source:HGNC Symbol;Acc:9811]
Mouse Orthologue:
Rad21
Mouse Description:
RAD21 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:108016]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14114 Essential Splice Site Available for shipment Available now
sa44925 Nonsense Mutation detected in F1 DNA Not yet available
sa10727 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14114
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Essential Splice Site 230 637 5 13
ENSDART00000132800 Essential Splice Site 230 637 6 14
Genomic Location (Zv9):
Chromosome 19 (position 45588408)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44486630
GRCz11 19 44082203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATGACTTTGGAGACAATCCAATGGAGAGCACTGAAGGAGGCATGCTGG[G/A]TAATAGAGGCATCTATAATATYCYCCGMTGTATAGGCTTTRTGTGGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44925
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Nonsense 297 637 7 13
ENSDART00000132800 Nonsense 297 637 8 14
Genomic Location (Zv9):
Chromosome 19 (position 45584394)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44482616
GRCz11 19 44078189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGATTCTGGCCCTGTGGAGCCTTTGCCCACCATGACAGACCAGACTGAA[C/T]AGACCACACTAGTCCACAATGAAGAGGAGGCCTTTGCTTTGGAGCCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10727
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051717 Nonsense 310 637 7 13
ENSDART00000132800 Nonsense 310 637 8 14
Genomic Location (Zv9):
Chromosome 19 (position 45584354)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44482576
GRCz11 19 44078149
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGACTGAACAGACCACACTAGWCCACAATGAAGAGGAGGCCTTTGCTT[T/A]GGAGCCCATCGACATCAMAGGTCAGTCAGAAGAGAAAAGTAGTWGCACAG
Associated Phenotype:
Not determined