Busch Lab

ZMP

evla

Ensembl ID:
ENSDARG00000035650
ZFIN ID:
ZDB-GENE-000607-65
Description:
Enah/Vasp-like a [Source:RefSeq peptide;Acc:NP_955813]
Human Orthologue:
EVL
Human Description:
Enah/Vasp-like [Source:HGNC Symbol;Acc:20234]
Mouse Orthologue:
Evl
Mouse Description:
Ena-vasodilator stimulated phosphoprotein Gene [Source:MGI Symbol;Acc:MGI:1194884]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa23116 Missense Available for shipment Available now
sa23115 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23116
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051697 None None 387 None 13
ENSDART00000125195 Missense 354 638 6 14
ENSDART00000138346 None None 212 None 6

The following transcripts of ENSDARG00000035650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 30970329)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30894256
GRCz11 17 30911219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAAGCCCTTCTGGAGGTCCTCTGCACCCACATTATCCCATACAAGAA[T/A]CGTCTTGCCCCCTTCCACCTCTCATTGGCCAGTCAGTCCAAGGCCCCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23115
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051697 Nonsense 371 387 12 13
ENSDART00000125195 Nonsense 622 638 13 14
ENSDART00000138346 None None 212 None 6

The following transcripts of ENSDARG00000035650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 30960575)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30884502
GRCz11 17 30901465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACAAGGAGATCTTGGAGGAGGTCGTTCGTGAATTGCAGAAAGTAAAA[G/T]AGGAAATAATTGATGGTAGGTTTTGAGGAATCCAGGATTATTTAAAAAAA
Associated Phenotype:
Not determined