Busch Lab

ZMP

irx4a

Ensembl ID:
ENSDARG00000035648
ZFIN ID:
ZDB-GENE-040426-1825
Description:
iroquois-class homeodomain protein IRX-4 [Source:RefSeq peptide;Acc:NP_991261]
Human Orthologue:
IRX4
Human Description:
iroquois homeobox 4 [Source:HGNC Symbol;Acc:6129]
Mouse Orthologue:
Irx4
Mouse Description:
Iroquois related homeobox 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355275]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17778 Nonsense Available for shipment Available now
sa17695 Nonsense Available for shipment Available now
sa45557 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17778
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 126 440 3 5
ENSDART00000051693 Nonsense 126 440 3 5
Genomic Location (Zv9):
Chromosome 16 (position 279615)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 290131
GRCz11 16 381459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGGWTAACACCGGCTGCCRCATATTACCCATACGATCCCACCCTGGGA[C/T]AGTACCAGTATGACAGGTATTGAAMWKCGGCCATCATAAGAGTCTTCTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 126 440 3 5
ENSDART00000051693 Nonsense 126 440 3 5
Genomic Location (Zv9):
Chromosome 16 (position 279615)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 290131
GRCz11 16 381459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGGGWTAACACCGGCTGCCRCATATTACCCATACGATCCCACCCTGGGA[C/T]AGTACCAGTATGACAGGTATTGAAMWKCGGCCATCATAAGAGTCTTCTGW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45557
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051693 Nonsense 194 440 4 5
Genomic Location (Zv9):
Chromosome 16 (position 280213)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 289533
GRCz11 16 380861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGATGACCCTCACTCAGGTGTCCACCTGGTTCGCCAACGCCAGAAGG[A/T]GACTCAAGAAGGAGAACAAGATGACCTGGCCACCGAGGAACAAGGGCTCG
Associated Phenotype:
Not determined