Busch Lab

ZMP

si:ch211-89f7.3

Ensembl ID:
ENSDARG00000035633
ZFIN ID:
ZDB-GENE-030131-751
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BIR1]
Human Orthologue:
TCTN2
Human Description:
tectonic family member 2 [Source:HGNC Symbol;Acc:25774]
Mouse Orthologue:
Tctn2
Mouse Description:
tectonic family member 2 Gene [Source:MGI Symbol;Acc:MGI:1915228]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa33549 Nonsense Available for shipment Available now
sa40369 Nonsense Mutation detected in F1 DNA Not yet available
sa40370 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8441 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8615 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33550 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33549
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 None None 597 None 16
ENSDART00000135921 Nonsense 131 709 4 18
Genomic Location (Zv9):
Chromosome 5 (position 14609197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12906634
GRCz11 5 13406851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCGCAGTCTCCAGCTGTGTGGGAATGAAACCTCCATCTCGGACTGCTG[T/A]CTGGAGTTGCTTTGTGTCCAGGAGACTCTGCTTGTGTCTGCTTGTGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40369
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Nonsense 46 597 2 16
ENSDART00000135921 Nonsense 181 709 5 18
Genomic Location (Zv9):
Chromosome 5 (position 14612352)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12909789
GRCz11 5 13410006
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATCATATCTTTTTGTGTTTTGCAGTAAATAAAACAGTCATTCCCAAC[C/T]AAGTATTTCAGCCGCTCGGCCAGTGCCCGTGTGACGTTTCTCCAGGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 252 597 6 16
ENSDART00000135921 Essential Splice Site 387 709 9 18
Genomic Location (Zv9):
Chromosome 5 (position 14617518)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12914955
GRCz11 5 13415172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGACAACATCAGATTATTTGTGTCAAATTCTCCTGAGGTCACTTCAGG[T/C]CAGTTATTCAGGTTAACATTTTGAGCAGTCACCAATTTTAAAATCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8441
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
Genomic Location (Zv9):
Chromosome 5 (position 14618819)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916256
GRCz11 5 13416473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCACCGCCATTGCTGTGACACGAACCACWGCAAACATCACTGTACCTGG[T/C]GAATATCACTCTCTCAATATAAAATACAGCTTTACTGCAYSTGCTTGTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8615
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
ENSDART00000051669 Essential Splice Site 290 597 7 16
ENSDART00000135921 Essential Splice Site 425 709 10 18
Genomic Location (Zv9):
Chromosome 5 (position 14618819)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916256
GRCz11 5 13416473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCACCGCCATTGCTGTGACACGAACCACWGCAAACATCACTGTACCTGG[T/C]GAATATCACTCTCTCAATATAAAATACAGCTTTACTGCAYSTGCTTGTCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33550
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 316 597 8 16
ENSDART00000135921 None None 709 None 18
Genomic Location (Zv9):
Chromosome 5 (position 14618990)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12916427
GRCz11 5 13416644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGTGAATGGAAACGAGACCTCTCAGTCGTACTCCGGTAAGCCAA[C/A]ACAAATGATGTGAATTTGTATTTAGGAATGTAATGATATTTTTTATAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8176
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051669 Essential Splice Site 347 597 9 16
ENSDART00000135921 Essential Splice Site 482 709 12 18
Genomic Location (Zv9):
Chromosome 5 (position 14620502)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12917939
GRCz11 5 13418156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGAAACAGGAGTTGTACAGAGGACCCAGATCAGTCTGTGGCAGCCAGG[T/C]AGCATATTARTCCAGAGTTTCTGTAGGTTCTTAAAAAGTTWGYTTAAAAC
Associated Phenotype:
Not determined