Busch Lab

ZMP

ankle2

Ensembl ID:
ENSDARG00000035607
ZFIN ID:
ZDB-GENE-030131-6090
Description:
ankyrin repeat and LEM domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001119867]
Human Orthologue:
ANKLE2
Human Description:
ankyrin repeat and LEM domain containing 2 [Source:HGNC Symbol;Acc:29101]
Mouse Orthologue:
Ankle2
Mouse Description:
ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa26430 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40384 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5287
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Nonsense 123 961 2 13
ENSDART00000142531 Nonsense 123 206 2 3
ENSDART00000145210 Nonsense 123 961 2 13
Genomic Location (Zv9):
Chromosome 5 (position 20739890)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18452349
GRCz11 5 18956141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTGTGCGCCTGTAAWGTGGAGAACACGCAGACTCCCTCTAAAACTGCA[C/T]AGGTGTCACCCACCTTCTACGGAGTGTGTCCATTGTGGGAGGATGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26430
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Essential Splice Site 400 961 7 13
ENSDART00000142531 None None 206 None 3
ENSDART00000145210 Essential Splice Site 400 961 7 13
Genomic Location (Zv9):
Chromosome 5 (position 20732307)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18444766
GRCz11 5 18948558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGGTAAAGTTCAAGAAGTCAAACAGAAAATAAATGAATATTTAGAAG[G/A]TAAGCTGATGATATTACTTGTTGTATTTAATTTAACATGTTGATCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40384
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090521 Nonsense 776 961 11 13
ENSDART00000142531 None None 206 None 3
ENSDART00000145210 Nonsense 776 961 11 13
Genomic Location (Zv9):
Chromosome 5 (position 20730560)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18443019
GRCz11 5 18946811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGATGAGTACTTTCTGGCCAGTGAGCGGCTGGAACCTATAAACCAA[C/T]AGACTATAGATACTTCAGGGTGCGAGCGCATGATCTGCGCCAGGTCAAAG
Associated Phenotype:
Not determined