Busch Lab

ZMP

tchp

Ensembl ID:
ENSDARG00000035605
ZFIN ID:
ZDB-GENE-060421-3368
Description:
Trichoplein keratin filament-binding protein [Source:UniProtKB/Swiss-Prot;Acc:Q1RM03]
Human Orthologue:
TCHP
Human Description:
trichoplein, keratin filament binding [Source:HGNC Symbol;Acc:28135]
Mouse Orthologue:
Tchp
Mouse Description:
trichoplein, keratin filament binding Gene [Source:MGI Symbol;Acc:MGI:1925082]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa31424 Splice Site, Nonsense Available for shipment Available now
sa26437 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33566 Essential Splice Site Available for shipment Available now
sa14422 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26436
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Nonsense 170 499 4 12
Genomic Location (Zv9):
Chromosome 5 (position 21655355)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19368227
GRCz11 5 19872027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAGTCAGAGCTGCACAAAGATCACATTGTGAGTCAGTGGCAGGTT[C/T]AACAGCAAGAGAAAAAACAGGTAAGACATGTTAAATGTCGGCACAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Splice Site, Nonsense 176 499 4 12
Genomic Location (Zv9):
Chromosome 5 (position 21655373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19368245
GRCz11 5 19872045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGATCACATTGTGAGTCAGTGGCAGGTTCAACAGCAAGAGAAAAAA[C/T]AGGTAAGACATGTTAAATGTCGGCACAAGCATGAATGCAACTCGGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26437
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Essential Splice Site 272 499 6 12
Genomic Location (Zv9):
Chromosome 5 (position 21656396)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19369268
GRCz11 5 19873068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGAGGAAGATGATGGAGGAAAGCAGAAGGAAAACGGAATTTGGG[T/C]GAAAAATTTAGACTTAAATATTGTATGTGTTAAGGGATTTATTTCTTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26438
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Nonsense 350 499 8 12
Genomic Location (Zv9):
Chromosome 5 (position 21657573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19370445
GRCz11 5 19874245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGGAGCAGCTTCAGCTGGAGAGGGAGAGGGAGGCAGAGTTTGACATTT[T/A]ATACCGGTGAGCGCACAGGCAAAATGTTTAATCAACTGTGTTTGTATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Essential Splice Site 380 499 10 12
Genomic Location (Zv9):
Chromosome 5 (position 21659265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19372137
GRCz11 5 19875937
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTAAATGTAGTCAAATTTGTGACCGTTAGTTTGTGTGATATTTTTTGTC[A/G]GGTCCTGGCAGGTCGTCAGCAGCAGTTGCAGGAGCGAATGCAGGAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14422
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051614 Nonsense 480 499 11 12
Genomic Location (Zv9):
Chromosome 5 (position 21662134)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19375006
GRCz11 5 19878806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGGGAGGAGCTTAGGCTCCAGGAGGAGGAACTTCGTCTTGAGACGGAC[C/T]GAATGATTCGACAGGGCTTYCAGGAGAGAGTGAGTGGAGATTAAKGTGCT
Associated Phenotype:
Not determined