Busch Lab

ZMP

dao.3

Ensembl ID:
ENSDARG00000035601
ZFIN ID:
ZDB-GENE-040426-1894
Description:
D-amino acid oxidase [Source:RefSeq peptide;Acc:NP_991257]
Human Orthologue:
DAO
Human Description:
D-amino-acid oxidase [Source:HGNC Symbol;Acc:2671]
Mouse Orthologue:
Dao
Mouse Description:
D-amino acid oxidase Gene [Source:MGI Symbol;Acc:MGI:94859]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38457 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6967 Nonsense Mutation detected in F1 DNA Not yet available
sa16754 Essential Splice Site Available for shipment Available now
sa26442 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38457
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051611 Essential Splice Site None 353 None 11
ENSDART00000122587 Essential Splice Site None 224 None 12
Genomic Location (Zv9):
Chromosome 5 (position 21986624)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19699496
GRCz11 5 20203296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTATTATATGCAGCAAATATGCTCACTTTTAAGGCACTCTTCTGTCTGC[A/T]GTCATGAAGGTGTGCATCATTGGCGCAGGGGTCATCGGTCTCTCCACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6967
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051611 Nonsense 151 353 6 11
ENSDART00000122587 Nonsense 28 224 6 12
Genomic Location (Zv9):
Chromosome 5 (position 21984502)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19697374
GRCz11 5 20201174
KASP Assay ID:
554-5156.1 (used for ordering genotyping assays)
KASP Sequence:
AAACTTAAGANNNNNNACACATATGAATCATTTTCTTGTTTTCTTAACAG[G/A]TTAAAAGAAAGAAATGTCAAGTTTTATCAAAGAAAGATTGATTCATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051611 Essential Splice Site 204 353 7 11
ENSDART00000122587 Essential Splice Site 81 224 7 12
Genomic Location (Zv9):
Chromosome 5 (position 21983542)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19696414
GRCz11 5 20200214
KASP Assay ID:
2259-5639.1 (used for ordering genotyping assays)
KASP Sequence:
ARCTGCAGCCTGATCCTGAGCTCCAGCCAGCCAGAGGACAGATCATTAAG[G/A]TGACTTTTAATGGWTTAATTGCCTAATTCCCTCTGTCTTCACTGGATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26442
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051611 Essential Splice Site 231 353 8 11
ENSDART00000122587 Essential Splice Site 108 224 8 12
Genomic Location (Zv9):
Chromosome 5 (position 21981376)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19694248
GRCz11 5 20198048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACACATAATTTCTCGTCTAGGGGTAATTCAGCTTACATCATACCTGG[G/A]TGAGCATCTTCATGATCAAAATCAAATCCTATTCACAAAATATTAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20379
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051611 Nonsense 246 353 9 11
ENSDART00000122587 Nonsense 123 224 9 12
Genomic Location (Zv9):
Chromosome 5 (position 21981216)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19694088
GRCz11 5 20197888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGGAGTCGTTTGGTCACTGTTGGTGGAGTTTTCCAAGTGGGAAACTG[G/A]AATCGGCTGAACAGTTCTGTTGACCATAAACAAATCTGGGAAGCCGCCTG
Associated Phenotype:
Not determined