Busch Lab

ZMP

ficd

Ensembl ID:
ENSDARG00000035595
ZFIN ID:
ZDB-GENE-030131-6588
Description:
Adenosine monophosphate-protein transferase FICD [Source:UniProtKB/Swiss-Prot;Acc:Q6ZM51]
Human Orthologue:
FICD
Human Description:
FIC domain containing [Source:HGNC Symbol;Acc:18416]
Mouse Orthologue:
Ficd
Mouse Description:
FIC domain containing Gene [Source:MGI Symbol;Acc:MGI:1098550]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26443
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051606 Nonsense 105 449 3 3
ENSDART00000144232 Nonsense 105 449 3 3
Genomic Location (Zv9):
Chromosome 5 (position 22270832)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19983704
GRCz11 5 20487504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTCCAGAGACTCAGTTGGAGGCAAAAGCAGCTCTCCAGCAGGCTCTG[G/T]AGATGAAGAAAAGTGGGAAAAGAGAGAAAGCCCACAAGCTGCTTGTCCAT
Associated Phenotype:
Not determined