Busch Lab

ZMP

si:ch211-106a19.2

Ensembl ID:
ENSDARG00000035565
ZFIN ID:
ZDB-GENE-060526-4
Description:
V-type proton ATPase 116 kDa subunit a isoform 2 [Source:RefSeq peptide;Acc:NP_001116219]
Human Orthologue:
ATP6V0A2
Human Description:
ATPase, H+ transporting, lysosomal V0 subunit a2 [Source:HGNC Symbol;Acc:18481]
Mouse Orthologue:
Atp6v0a2
Mouse Description:
ATPase, H+ transporting, lysosomal V0 subunit A2 Gene [Source:MGI Symbol;Acc:MGI:104855]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa45200 Nonsense Mutation detected in F1 DNA Not yet available
sa33591 Nonsense Mutation detected in F1 DNA Not yet available
sa33592 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40421 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Nonsense 4 849 1 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26213314)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24040579
GRCz11 5 24544379
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAACACTTCACTTGTGTGGAGAGGAGCCGTTTGATCACCATGGGTTCGT[T/A]GTTTCGGAGTGAGGAGATGTGTCTGGCCCAGCTCTTCCTGCAGTCCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33591
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Nonsense 151 849 5 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26216555)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24043820
GRCz11 5 24547620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTGCTTGGTTTTTGCTTGTGTGGGAGCAGAGAGAGTCAACACAGGGC[C/T]AGTATGAAGAATTCCCCTTTCTAGAGAAAGAACCCATGATGGACTACACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1830
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Essential Splice Site 177 849 5 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26216635)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24043900
GRCz11 5 24547700
KASP Assay ID:
554-1821.1 (used for ordering genotyping assays)
KASP Sequence:
GAACCCATGATGGACTACACCAGCATGCAGAGGCTTGGAGCCAAGCTTGG[G/A]TGAGCAGTGTTTAAAACATTAACCTTTGTCATGACCTTTGACCTTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33592
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Essential Splice Site 247 849 8 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26218208)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24045473
GRCz11 5 24549273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTACTGTATTTTTAAGTTAAAATTGCTGATCAGAAACTTTTGTGTCTGT[A/G]GCTACCACTGTCACCTGTACCCATACCCCAACAGTAATGAGGAGAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40421
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029699 Nonsense 636 849 15 20

The following transcripts of ENSDARG00000035565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 26226140)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24053405
GRCz11 5 24557205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTTATCAACATGTTCCTGATGATGGGCGACTCTGGCCGACCACTCTA[T/A]CCAGGACAGGTGAGAGTCAAGCAATCATGATGAACAGAATGCTTCATTTC
Associated Phenotype:
Not determined