Busch Lab

ZMP

rps6ka3a

Ensembl ID:
ENSDARG00000035556
ZFIN ID:
ZDB-GENE-030219-119
Description:
ribosomal protein S6 kinase alpha-1 [Source:RefSeq peptide;Acc:NP_997951]
Human Orthologues:
RPS6KA3, RPS6KA6
Human Descriptions:
ribosomal protein S6 kinase, 90kDa, polypeptide 3 [Source:HGNC Symbol;Acc:10432]
ribosomal protein S6 kinase, 90kDa, polypeptide 6 [Source:HGNC Symbol;Acc:10435]
Mouse Orthologues:
Rps6ka3, Rps6ka6
Mouse Descriptions:
ribosomal protein S6 kinase polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:104557]
ribosomal protein S6 kinase polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:1914321]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10515 Nonsense Available for shipment Available now
sa40417 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14662 Nonsense Available for shipment Available now
sa6974 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2273
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Essential Splice Site 33 732 2 22
Genomic Location (Zv9):
Chromosome 5 (position 25693101)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23520366
GRCz11 5 24024166
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGTTTTGCAGGATGACTCCATGATTGAGGATGATTCTCTTGTTCACG[T/C]AAGTTGAAGACTGTCTGACTAACTATGTGTGTATTTATGTGAGTATGTTC
Long Flanking Sequence:
GGAATTCGGACGTACTACATCCGCCATTTTGTCATTGTCACGTGACCTACCTGCGTCAATTGCGTCGCTTTACTCCCATTCATGAATTCGCTCGCGTGGCATCATGGGATAGCGCAGCATGCATGGGATGCGCACTCCAGAATCTCGCCGGATGTAGTAAGTCATCCGGGTACTTATCGCATACGGATTTTCGAATTCTATGAATTCGGACATATTACTCGGCTCGCATACTGATTTTAGTGTACTATATAGTATGGAAGTATGTGGTTTCGGATGCAGCCAAGGCGTTCAAGACTACTAGAGACTATTAAGCAGCTTTGAGTTGGAGGTGGTTGGAGCTTAACTATGCAGAGCTGCGGCCCTTCAGGAATTAAATTTCAGACGATTGCTGTGAATGTTTTTGTAATAATAAAATAATGTAAGAAGGTTTTGTATTAACGTCATTTCTTTTTCTGTTTTGCAGGATGACTCCATGATTGAGGATGATTCTCTTGTTCACG[T/C]AAGTTGAAGACTGTCTGACTAACTATGTGTGTATTTATGTGAGTATGTTCTATTAGTTTTGTGTCCATCGGTTTAGCATTATTACTGCAAAATGTAACCATACGAGAGTGAAAGTTTATTATTTGCATTTGTTTTTAAGAACTGTGACCATGTGAGCTTTACAAGAGATTTTAAAGCATTTGGACATGCTATACCACTTGTAACTTTACAATTTAAATTTTATTTGTATTGGATTATTTATATATTTATACAATGAAGGTCCATAGTTATTTTACATTTGATTTCAAAATTTATATTGTTAAATATTGACTGAATTCTCAGGAGACCATAAAGCATTTATTTAATTTTCTCTGACTCAATATAAATTATTTATCTATCCAAATAGAACGATTAATGTCATCTGGTGAGCAGTTGTGTGTATTTTGAGTCGTTGTAGTATGCAGAATATAGCTGTCATAATTAATGCTGATGGGTACAGCACAGCAGTTCAAGTCCATAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10515
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 101 732 5 22
Genomic Location (Zv9):
Chromosome 5 (position 25687339)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23514604
GRCz11 5 24018404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATTTAAGCGTGTTATTGTTYGTTTACAATCTGGTTTGTGGTTTCAGTG[C/T]GAGATCGAGTGCGTACAAAAATGGAGAGGGACATTCTTGTTGAGGTCAAC
Long Flanking Sequence:
TCATGTATAGCTACCCAATCTGGCCATTAACACCTATGCGATCACCATCAATCCATCTTATTAAAACATTTTAATTTAAAAATTGTTTTTGCATTATTGTTTTTTTTTCCTTACAGTAAGATTTGCTTTAAAAGTTCTCCATTTATTTACTAAAGTAATTGACAGTTATGTTTTGTTCTATTTGGTAAGGGTTATTGGGTTTGTAAATGGATATATTTGAAAATTAATAAAAAAAATATTAATACTGAATTATTGTTATTAAATGTATTAAATTAATATTTTTTTGATCGGACAAGTGAAAATCTTTTCTAAATGGGATATTTGAAAAACATACTTTAGCATTTAGCCTTGTACAAGTTGAAAATTTCATACATAATGATCTTAAAAGTCTTAAATCAAACTTGATGAAACATGTAGAAACTCTGTTGAATGCACACACTCGGCTGAAGGAAATTTAAGCGTGTTATTGTTCGTTTACAATCTGGTTTGTGGTTTCAGTG[C/T]GAGATCGAGTGCGTACAAAAATGGAGAGGGACATTCTTGTTGAGGTCAACCACCCATTTATTGTTAAACTGCACTATGGTGAGTCTTTGACATCTTATCGCTGATCAGATTCTCACACTTCATGGTAGTTTTTTTTACTTTAATTTAAACTTGCTATTTATCTACTTAATCTCTGGATTAATTTTATTTATTTATTTGTTTGTTTGTTATCATTTTTGTGTTTCCAATGCCTCGCCCAGTTAACTTTGTTTACGCTTGATATTAAAAGGATAGTTTGCCCTCCCTTATATATTATACATATATTGCGCTCTAAACCCATATACATTTCGTTTTTTTCTGCTGATCACAAAGGAAGATATTTGGAAGAATGTCAGCGATCAAACAGATCTCAACACACTAACTCTGCCGTAGTTGGAAAAATAAATACTATGGGAGTGAGTAGGTGACAAGATCTGTTTGGTTATTGACATGCTTCCAAACAACTTCCTTTGTGTTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Essential Splice Site 189 732 8 22
Genomic Location (Zv9):
Chromosome 5 (position 25685728)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23512993
GRCz11 5 24016793
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGCAGTGCACATTTTAATAAGTGCTCAATTTCTTGATTTCTTTTACA[G/A]TATTCTCTTGGATGATGATGGACACATCAAACTTACAGGTATGTGTGCTT
Long Flanking Sequence:
ATCTGTTTTTTTATCACTATTCTCATTTTTTATTAATGTGCCTTTTCTGAGAAAAAATTAATAATATCTTTAAAAATTAAGTTTGAACTGTAATGTATTTGTTAATCTTATTTTAGAGATGTAAATATTTAAATGAGCTTTAAATCATTAAACATAAGGAAATGATGTAAGAATATCTAAACATTCTACCACTCTCTTGTAGGTGATGTTTACAGAGGAGGATGTTAAGTTTTACCTAGCAGAGCTGGCTCTGGCACTAGACCATTTACATGGACTGGGAATCATCTACAGAGATCTCAAACCAGAAAAGTGCGTTTCTCACCCACATATTACATACAAAGTGAGGTGGCCCAGCTCAAAGTACAGCAGCAAACTATATAGTAACCACTACACATTTCCTTATAAAAACTATTTTATCAATCACCATATAGTATATAGATATTAGAAAGCCAGCGCAGTGCACATTTTAATAAGTGCTCAATTTCTTGATTTCTTTTACA[G/A]TATTCTCTTGGATGATGATGGACACATCAAACTTACAGGTATGTGTGCTTTATCTATCCAAGAGAACATATTGCTTTTATTATAATGAGTGAATTTGGGTCATAAATGATAAAAGATTAATGTTATAACTGTTTTTTGTGAGTCACGTCATGATAAGTATGTTAGTATGTCTCAGATTTGGTTTGTCTGCACGTGTTACATAGATTTTGGTTTGAGTAAGGAGTCCATTGACCATGAGAACAAGGCATATTCGTTTTGTGGTACGGTGGAATATATGGCTCCAGAAGTTGTCAACCGCAGAGGTCACACCCAGAGTGCCGACTGGTGGTCTTATGGTGTGCTAATGGTGAGGAGGTTTGGTTTTAGATGTACCAAAGTTAAAAATAATATTTGGGTCACTGTGGGCTAATTATAATGCATTTCTATTACCGCAGTTTGAAATGCTAACTGGAGCACTTCCATTCCAAGGGAAAGACCGAAAGGAGACCATGACAATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 500 732 17 22
Genomic Location (Zv9):
Chromosome 5 (position 25682445)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23509710
GRCz11 5 24013510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTCACAGAGTTGATGAAAGGTGGAGAACTACTGGATAAAATCCTCCGA[C/T]AAAARTTTTTCTCTGAGAGAGAAGCAAGCGCTGTCCTCTACACCATWACA
Long Flanking Sequence:
TTTTAAATAGAAGATACATTTATATTATATTTGAGTTTATAACTGTGTAATATTTTCATAGTTTATGCATTCATAATTATTAATATAGTCTTTATTCTATATTCTGTAGTCATTATTAAACTTAATTTGTCTTAGATCAAATAAATGCAGTACTTTTTCCAAATGAAATGTTAAAATATTTATATTTTATAGAATCATATTAGTATCTTTAGATATGGTTCTAAATAGTTCTGATTGGATTGCAGATCATTAAAAAGGAGAGAAGAGATCCAACAGAGGAGGTTGAGATCCTGCTGCGGTACGGACAACATCCCAACATCATCACCCTGAAGGACGTGAGTGACATTTGTTCTGTAGAAGATCATAACTAGACTGTCTCAGGTGTTGTTTGCTTCTATTTTGAGTCTGTTTGGGATTATTAGGTCTTTGATGATGGCCGATCAGTGTACCTGGTCACAGAGTTGATGAAAGGTGGAGAACTACTGGATAAAATCCTCCGA[C/T]AAAAGTTTTTCTCTGAGAGAGAAGCAAGCGCTGTCCTCTACACCATTACAAAGACTGTTGAATATCTGCATGCCCAAGGGGTAAGAACACTTAACATGGACTAAATTCACTTTTACAACACACTGAAAGTTTGTATATATTAGGGCTGGGCCGATAAACGATATTATATCGAATTGCGATACAATTTATGTCAATAACAATGATAAGCTCTGCACTGTTTTACTCTATTCTGATCTAGAAGCCAATCACACAGCAGAAATGTGTAACAATGAGAATCTAGAAGTGTGTTGGTATTAGAGATGGACCAAACTTTCGGCTACCTAAAATGTTATGCCATTTAATTAACCCTTTAATTTTTGTGGCTTTGGTCATTGTTTGGGGTACTCTTTTAAATCTGGAAGCTTTCACAAATTATATCCAAAAATTTATACCGTTATCGTTTAATATGGACAATAATCATCAGGATTTGCATTTTTGCCATATCGCCCAGCCCTAGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6974
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051546 Nonsense 684 732 21 22
Genomic Location (Zv9):
Chromosome 5 (position 25680703)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23507968
GRCz11 5 24011768
KASP Assay ID:
554-5278.1 (used for ordering genotyping assays)
KASP Sequence:
GCCATYCATGGATAATCAACAAGGACCAGTTACCCAAATACCAACTCAAT[C/T]GACAGGATGCTCCTCACCTAGTGAAGGTTTGCTTTGCTRTAATGGWCTCA
Long Flanking Sequence:
GTTGCAATATTTTAAAGCCATAATATATTGCACAGGTCAATGTATACTTTCTGCCTGGATTTTTTAAAACATATATTCCAGGTACATATCATAATTTTTTTAAACTCCCAATACTCGTTTGTTTAGGTTCACTCCATTTGCAAATGGTCCAGAAGACACACCGGAGGAGATTCTGGCTCGCATTGGCAGTGGCAAATTCTCATTGACTGGTGGATACTGGAATTCTGTATCACATGATGCAAAGGTTGTAGGCTCTCTTTTTGTTTAACACCCTTTCTAGCCCAATGAATTTATTAAACACTTTGTTCCTGTTTTCGTCATTGTTGTGGATGAAAACGCTGATGAATGCACATGCTCTGTTTAATCTAACATCTTTAAACTGACAGGACCTTGTATCAAAGATGCTGCATGTTGACCCTCATAAGAGATTAACGGCAGCTCAAGTACTTCGCCATCCATGGATAATCAACAAGGACCAGTTACCCAAATACCAACTCAAT[C/T]GACAGGATGCTCCTCACCTAGTGAAGGTTTGCTTTGCTATAATGGTCTCAGATGTAAAACTGATGATTTTAGAAATGGTTGACTAATTTTATTATCTTCCATGTTTACCCAACTGGCCTAAATATATCTTTACCTAAGCATTATGATAGTTAAACTGATTGTTCACCCCAAAATGACTATTCTTTCCTTATTTACTCATGCTTTTTCATTGCAAAAGACTTTATTCATTTTAGAAACACAAAGTCACATTAGTTGCAAAGTATATTTGTAGGAATGGCCAACATTAAGGTTAAATTATTGTTTTTTCTTTTAAGGCAAAAATGGTTTGAGTTTTAAGTAAAGATATTTAGTAAATTTCCTTCTGTTAATGTATAATAACTTTAGTGGTAACACTTAACAATGAAGTTGTATGAGTTAATGTATTTACTAACATGAATGAACAATGAACAATTGTTTATGTTAGTTAATGAAGTGGTTCATTGTTAGTAATAATGTACAAT
Associated Phenotype:
Not determined