Busch Lab

ZMP

rasa1

Ensembl ID:
ENSDARG00000035535
ZFIN ID:
ZDB-GENE-030131-4694
Description:
Novel protein similar to vertebrate RAS p21 protein activator (GTPase activating protein) 1 (RASA1)
Human Orthologue:
RASA1
Human Description:
RAS p21 protein activator (GTPase activating protein) 1 [Source:HGNC Symbol;Acc:9871]
Mouse Orthologue:
Rasa1
Mouse Description:
RAS p21 protein activator 1 Gene [Source:MGI Symbol;Acc:MGI:97860]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa10485 Nonsense Available for shipment Available now
sa15062 Nonsense Available for shipment Available now
sa20521 Nonsense Available for shipment Available now
sa15906 Essential Splice Site Available for shipment Available now
sa33700 Nonsense Mutation detected in F1 DNA Not yet available
sa9711 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 324 972 8 26
ENSDART00000139824 Nonsense 319 952 8 25
Genomic Location (Zv9):
Chromosome 5 (position 49709854)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47275552
GRCz11 5 47927063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATTAGCCCCACTCCCAACAATCAGTACATGATGGGAGGACGCTACTA[T/A]AACAGGTAGGAATGCAGGCTGRGGTTTAAATGCCTGAAAGCATCAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15062
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 368 972 10 26
ENSDART00000139824 Nonsense 363 952 10 25
Genomic Location (Zv9):
Chromosome 5 (position 49715088)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47280786
GRCz11 5 47932297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCAAAAAGAGCAAGTTCTATCTGATTTGGTTGATGGCAGAGAAATATA[T/A]AACACTATTCGACGAAAAACAAAAGATGCTTTCTACAAAAACATCGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20521
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 373 972 10 26
ENSDART00000139824 Nonsense 368 952 10 25
Genomic Location (Zv9):
Chromosome 5 (position 49715101)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47280799
GRCz11 5 47932310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTCTATCTGATTTGGTTGATGGCAGAGAAATATATAACACTATTCGA[C/T]GAAAAACAAAAGATGCTTTCTACAAAAACATCGTCAAGAAAGGATATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15906
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Essential Splice Site 739 972 18 26
ENSDART00000139824 Essential Splice Site 734 952 18 25
Genomic Location (Zv9):
Chromosome 5 (position 49732880)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47298578
GRCz11 5 47950089
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTAAAGACACCATACTGAAGATCATGGAGAGCAAGCAGTCMTGYGAG[G/A]TACAGCAAATAAACAAATAATAATATCCCACTTTTAAAAGGATAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Nonsense 788 972 20 26
ENSDART00000139824 Nonsense 783 952 20 25
Genomic Location (Zv9):
Chromosome 5 (position 49736336)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47302034
GRCz11 5 47953545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGTCCATTTCCTGTCCCAGGACCCTGAGGTACATTTATGGCTGTCTT[C/T]AGAAGTCAGTGCAGCAGAAATGGCCGACCAACACTACAATGAGGACCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051518 Essential Splice Site 859 972 22 26
ENSDART00000139824 Essential Splice Site 854 952 22 25
Genomic Location (Zv9):
Chromosome 5 (position 49738700)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 47304398
GRCz11 5 47955909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCAAAGTCTGTGCAAAACTTGGCCAACCTGGTGGAGTTTGGTGCCAAG[G/T]TGTTTAGATTTTCACGCTSAGTTCTAAAATGATCTKTGCTGAGAGAATGC
Associated Phenotype:
Not determined