Busch Lab

ZMP

zgc:110380

Ensembl ID:
ENSDARG00000035519
ZFIN ID:
ZDB-GENE-050417-145
Description:
histone H1-like [Source:RefSeq peptide;Acc:NP_001017660]
Human Orthologues:
HIST1H1A, HIST1H1B, HIST1H1C, HIST1H1D, HIST1H1E, HIST1H1T
Human Descriptions:
histone cluster 1, H1a [Source:HGNC Symbol;Acc:4715]
histone cluster 1, H1b [Source:HGNC Symbol;Acc:4719]
histone cluster 1, H1c [Source:HGNC Symbol;Acc:4716]
histone cluster 1, H1d [Source:HGNC Symbol;Acc:4717]
histone cluster 1, H1e [Source:HGNC Symbol;Acc:4718]
histone cluster 1, H1t [Source:HGNC Symbol;Acc:4720]
Mouse Orthologues:
AC132288.1, Hist1h1a, Hist1h1b, Hist1h1c, Hist1h1d, Hist1h1e, Hist1h1t
Mouse Descriptions:
histone cluster 1, H1a Gene [Source:MGI Symbol;Acc:MGI:1931523]
histone cluster 1, H1b Gene [Source:MGI Symbol;Acc:MGI:1861461]
histone cluster 1, H1c Gene [Source:MGI Symbol;Acc:MGI:1931526]
histone cluster 1, H1d Gene [Source:MGI Symbol;Acc:MGI:107502]
histone cluster 1, H1e Gene [Source:MGI Symbol;Acc:MGI:1931527]
histone cluster 1, H1t Gene [Source:MGI Symbol;Acc:MGI:1888530]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40438 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40438
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124705 Nonsense 24 201 1 1
Genomic Location (Zv9):
Chromosome 5 (position 29077657)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26832955
GRCz11 5 27433108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCCGCGGCGGCTCCGGCCAAATCTCCGAGGAAGAAGGCGACAAAGGCG[A/T]AAAAGCCCGGACCCAGCGTGTCAGACCTCATCGTGAAGGCGGTTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26480
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124705 Nonsense 184 201 1 1
Genomic Location (Zv9):
Chromosome 5 (position 29078137)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26833435
GRCz11 5 27433588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGAAGAAAGTTGCAAAGAGTCCTAAGAAGGTCAAAGCAGTGAAACCT[A/T]AAGCTGCAAAGCCCAAGGCTGCCAAGGCGAAGAAGACGGCCGCCAAGAAG
Associated Phenotype:
Not determined