Busch Lab

ZMP

adam28

Ensembl ID:
ENSDARG00000035514
ZFIN ID:
ZDB-GENE-060929-532
Description:
a disintegrin and metallopeptidase domain 28 [Source:RefSeq peptide;Acc:NP_001070186]
Human Orthologues:
ADAM28, ADAM7
Human Descriptions:
ADAM metallopeptidase domain 28 [Source:HGNC Symbol;Acc:206]
ADAM metallopeptidase domain 7 [Source:HGNC Symbol;Acc:214]
Mouse Orthologues:
Adam28, Adam7
Mouse Descriptions:
a disintegrin and metallopeptidase domain 28 Gene [Source:MGI Symbol;Acc:MGI:105988]
a disintegrin and metallopeptidase domain 7 Gene [Source:MGI Symbol;Acc:MGI:107247]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31442 Nonsense Available for shipment Available now
sa33611 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa11354 Essential Splice Site Available for shipment Available now
sa40439 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31442
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098604 Nonsense 36 762 2 21
ENSDART00000130936 Nonsense 36 293 2 9

The following transcripts of ENSDARG00000035514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 29544252)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27299550
GRCz11 5 27899703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACAGTTGGTCACATTCACGAACTACATGGCAAGGTTTATGAGATTGTA[C/T]GACCAATAAGATTACATGATCTGCAAAAAAGAGACTTACAGGTGAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33611
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098604 Splice Site, Nonsense 453 762 13 21
ENSDART00000130936 None None 293 None 9

The following transcripts of ENSDARG00000035514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 29556826)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27312124
GRCz11 5 27912277
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGACTGTGGGCTCACAATGTGCAGCAGGAGAATGTTGTGACAACTGT[A/T]AGGTATAGTGGAGGTTTTTTGCTGTGTCATTCATCAAATCACCAAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098604 Essential Splice Site 453 762 13 21
ENSDART00000130936 None None 293 None 9

The following transcripts of ENSDARG00000035514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 29556829)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27312127
GRCz11 5 27912280
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACTGTGGGCTCACAATGTGCAGCAGGAGAATGTTGTGACAACTGTAAG[G/A]TAWAGTGGAGGTTTYTTGCTGTKTCATTCATCAAATCRCCAAAGGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40439
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098604 Nonsense 547 762 15 21
ENSDART00000130936 None None 293 None 9

The following transcripts of ENSDARG00000035514 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 29558547)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27313845
GRCz11 5 27913998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAAGAGCGGAGTACTACGCTTACTGCAAACGCAATGGAGATAAATA[T/G]ATTGGATGCCAAAAACAGTATGATTTTACATCTGTATTTATATTCATTCT
Associated Phenotype:
Not determined