Busch Lab

ZMP

cobra1

Ensembl ID:
ENSDARG00000035505
ZFIN ID:
ZDB-GENE-040426-765
Description:
cofactor of BRCA1 isoform 2 [Source:RefSeq peptide;Acc:NP_956462]
Human Orthologue:
COBRA1
Human Description:
cofactor of BRCA1 [Source:HGNC Symbol;Acc:24324]
Mouse Orthologue:
Cobra1
Mouse Description:
cofactor of BRCA1 Gene [Source:MGI Symbol;Acc:MGI:1931035]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20444 Essential Splice Site Available for shipment Available now
sa17245 Nonsense Available for shipment Available now
sa12379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 Essential Splice Site 34 591 1 15
ENSDART00000051471 Essential Splice Site 34 583 1 13
ENSDART00000133949 Essential Splice Site 34 577 1 13
Genomic Location (Zv9):
Chromosome 5 (position 31198145)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28959502
GRCz11 5 29559655
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCTGACTAACTGTACTGAACCTCTCAAAGCAATCGACCAGTTTCAGG[T/C]TAGATCTTTACAAACGTACACATGTCCTGTCTGTCATGTTCGTGATTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17245
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 Nonsense 293 591 6 15
ENSDART00000051471 Nonsense 293 583 6 13
ENSDART00000133949 Nonsense 293 577 6 13
Genomic Location (Zv9):
Chromosome 5 (position 31192395)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28953752
GRCz11 5 29553905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAAACGGGCCMGAGAGTTACAAGGCTTTTTGGATGGTGTGAAGAAAGGC[C/T]AGGAGCAAGTGTTAGGGTATGAGATTCAWWTTTAATTCTACAGACAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12379
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 None 378 591 9 15
ENSDART00000051471 Nonsense 378 583 9 13
ENSDART00000133949 Nonsense 378 577 9 13
Genomic Location (Zv9):
Chromosome 5 (position 31191412)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28952769
GRCz11 5 29552922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCCTTCAGGATCTGGAGGTGGTGACACGCTTTCTGCCTGCCATGATGT[C/A]RATAGTGGTGGACGACTACACGTTTACWGTRGAGCAGAAACWGCCGAGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2202
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051433 Essential Splice Site 531 591 13 15
ENSDART00000051471 Essential Splice Site 531 583 12 13
ENSDART00000133949 Essential Splice Site 525 577 12 13
Genomic Location (Zv9):
Chromosome 5 (position 31189375)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28950732
GRCz11 5 29550885
KASP Assay ID:
554-2529.1 (used for ordering genotyping assays)
KASP Sequence:
TGCCGACTTACATGGAAACCTTGATGAAGACGCTTGAACCACCAAAACAG[G/A]TATTTTTCAAGGAAACAAGACTCGCTAAAAGTGTTTTTTCATGTTAAGAA
Associated Phenotype:
Not determined