Busch Lab

ZMP

sh3glb2b

Ensembl ID:
ENSDARG00000035470
ZFIN ID:
ZDB-GENE-040426-833
Description:
SH3-domain GRB2-like endophilin B2b [Source:RefSeq peptide;Acc:NP_957413]
Human Orthologue:
SH3GLB2
Human Description:
SH3-domain GRB2-like endophilin B2 [Source:HGNC Symbol;Acc:10834]
Mouse Orthologue:
Sh3glb2
Mouse Description:
SH3-domain GRB2-like endophilin B2 Gene [Source:MGI Symbol;Acc:MGI:2385131]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20457 Nonsense Available for shipment Available now
sa1938 Nonsense Available for shipment Available now
sa30861 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16553 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3537
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Nonsense 59 373 2 10
ENSDART00000134427 Nonsense 59 238 2 7
ENSDART00000147065 Nonsense 59 402 2 12
ENSDART00000147779 Nonsense 59 397 2 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33320520)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31082752
GRCz11 5 31682905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATCGCTCGAGCAGACTGTACCAAAAACTGGACAGAGAAGATCTTCAGA[C/T]AGACCGAAGTGCTGCTTCAACCCAACCCAAGTAAGAATGAACCCAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20457
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Nonsense 77 373 3 10
ENSDART00000134427 Nonsense 77 238 3 7
ENSDART00000147065 Nonsense 77 402 3 12
ENSDART00000147779 Nonsense 77 397 3 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33316031)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31078263
GRCz11 5 31678416
KASP Assay ID:
2259-6014.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTACTGATGTGAATGTTTGTTCAGGTGCCCGTATTGAGGAGTTCTTCTA[T/A]GAGAAACTAGACAAAAAGATCCCATCCAGAATCACCAATGCAGAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Nonsense 134 373 4 10
ENSDART00000134427 Nonsense 134 238 4 7
ENSDART00000147065 Nonsense 134 402 4 12
ENSDART00000147779 Nonsense 134 397 4 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33309544)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31071776
GRCz11 5 31671929
KASP Assay ID:
554-1926.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTTGGAGAGTATCAAAAGAGGCTGGGTGGATCCGAGCGGGAATTTCTA[C/T]AAACATCAGCCATCAACTTCCTTACACCTCTGAGGAATTTTCTGGAGGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa30861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Essential Splice Site 187 373 5 10
ENSDART00000134427 Essential Splice Site 187 238 5 7
ENSDART00000147065 Essential Splice Site 187 402 5 12
ENSDART00000147779 Essential Splice Site 187 397 5 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33307924)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31070156
GRCz11 5 31670309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAAAGCTCGGCTCAAGAAAGCAAAGTTAGCAGAGGCCAAGGCAGCTG[T/A]AAGCTCTTATTTTGACTTATCTCAACATCTTTATGGTCACAAGATTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16553
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098172 Essential Splice Site 339 373 10 10
ENSDART00000134427 None None 238 None 7
ENSDART00000147065 Essential Splice Site 368 402 12 12
ENSDART00000147779 Essential Splice Site 363 397 11 11

The following transcripts of ENSDARG00000035470 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33282866)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31045098
GRCz11 5 31645251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGCGACACACCCAAGGGTCTTTTTCATGTTATTGTTTGTTTCTTTGTA[G/A]CTGATTACGGTGTACACGGTGCCCGGCATGGACCCAGACTGGCTTATCGG
Associated Phenotype:
Not determined