Busch Lab

ZMP

spns3

Ensembl ID:
ENSDARG00000035459
ZFIN ID:
ZDB-GENE-060531-7
Description:
Protein spinster homolog 3 [Source:UniProtKB/Swiss-Prot;Acc:A2CER7]
Human Orthologue:
SPNS3
Human Description:
spinster homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:28433]
Mouse Orthologue:
Spns3
Mouse Description:
spinster homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924827]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9844 Nonsense Available for shipment Available now
sa18804 Nonsense Mutation detected in F1 DNA Not yet available
sa40468 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40467 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9844
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612753)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373583
GRCz11 5 30973736
KASP Assay ID:
2259-5995.1 (used for ordering genotyping assays)
KASP Sequence:
TCGTTGGGCTGGTTATGTGGATCGTCACAACACTGGSAAGCTCTTTCGTC[A/T]GAAAATCGGTACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18804
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
ENSDART00000051392 Nonsense 135 500 3 12
ENSDART00000127787 Nonsense 135 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612753)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373583
GRCz11 5 30973736
KASP Assay ID:
2259-5995.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGTTGGGCTGGTTATGTGGATCGTCACAACACTGGGAAGCTCTTTCGTC[A/T]GAAAATCGGTACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Essential Splice Site 137 500 3 12
ENSDART00000127787 Essential Splice Site 137 498 3 12
Genomic Location (Zv9):
Chromosome 5 (position 32612744)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30373574
GRCz11 5 30973727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTATGTGGATCGTCACAACACTGGGAAGCTCTTTCGTCAGAAAATCG[G/A]TACAGTACAAAGTCTCACAGCTTCGATAACGTGTATATGATTTATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40467
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Essential Splice Site 308 500 8 12
ENSDART00000127787 Splice Site None 498 None 12
Genomic Location (Zv9):
Chromosome 5 (position 32604969)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30365799
GRCz11 5 30965952
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGTGGGGCTGAAATTGAATAACATCACATTGTTTCTTCTTTCTTTCA[T/C]GCGTAAGCTACATTTTTGGAGCAATCACAGTGGTGACAGGGGTTGTGGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26502
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051392 Essential Splice Site 374 500 9 12
ENSDART00000127787 Essential Splice Site 372 498 9 12
Genomic Location (Zv9):
Chromosome 5 (position 32603133)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30363963
GRCz11 5 30964116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGACCACAAGGATGCACTATTTGCTCTACAATGTATTTTTTTCTTAC[A/G]GACATTCATTGCTATTGGAGAGACTCTGCTGTCACTCAACTGGGCTATTC
Associated Phenotype:
Not determined