Busch Lab

ZMP

atp2a1l

Ensembl ID:
ENSDARG00000035458
ZFIN ID:
ZDB-GENE-041229-2
Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 like [Source:RefSeq peptide;Acc:NP_0010710
Human Orthologue:
ATP2A1
Human Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 [Source:HGNC Symbol;Acc:811]
Mouse Orthologue:
Atp2a1
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Gene [Source:MGI Symbol;Acc:MGI:105058]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa1409 Nonsense Available for shipment Available now
sa45455 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14828 Nonsense Mutation detected in F1 DNA Not yet available
sa22052 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19032
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
Genomic Location (Zv9):
Chromosome 12 (position 14354548)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13210201
GRCz11 12 13248504
KASP Assay ID:
2260-5101.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGATCAAGGCCAGAGAGATTGTGCCTGGTGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATT
Long Flanking Sequence:
TTCTCATCGCCAATGCTGTCGTTGGTGTGTGGCAGGTAACGCAAAAACACACACCAATAATTTATCACAGAAACAGAGGTTGCACTTTATTTTGATGGTTCATTTGTTGAATTTAAGTTATATTGCATCTACATGCCAATTAATTCTCATAAGACTATAGGTAGACTGATAGGGTTGGGGTTAGGGTTAGTGTAAGTTGACATGTACTTGCAAAGTTTCTTATAGTCAGTTAAATGTCTGTTGACATTGGCAGTGTCAACAGATTTTAAGCAGACAGTCTAGTAATGCTCAAATTGACCATCAAAATAAAGTGTTACCGCAACAGATACATGCAGATGATTGACAAATGTCTGCAACACAGGAGCGTAATGCAGAGAGCGCCATTGAGGCTCTGAAGGAGTATGAACCTGAGATGGGAAAGGTGTACCGCTCTGACAGGAAGAGTGTCCAGATGATCAAGGCCAGAGAGATTGTGCCTGGTGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATTATATTTTGAATACTTTTTGAAATTATTTATTACACCAAATCAACTTGAAATGCTTACATTTAGTGCTAAGGTTGATGTAGATGCGATACAACCGGGACGGATCCTAGCTGTTCAGATCAGTTGCTGTCTGTCTTGGTTATTGTAGAAAAAGAATAATTGTGGAGTAGTATCGTAAGATCTGATTTGCTTACTAAAACTATAATATTACTATATGACTATTAATATTGAATATGAACTATTAATCAAACTGGCCTTGCAAGATTTAAAGTCTTTGTGAAATAAAAATTTATATAACGCACATTGTTTTTCTTTACGACAACAATTTATCTGTGCAAGTTAATCCAATAAAAAGTGGCAGTGGAATGGCAGTCTTCTTTGTTGACATTAATTTGATGGCTTTATCCACAGTATTCTAAACTATACCCCTCTTACTGTTAGTTTGCTACTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7691
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
ENSDART00000105896 Essential Splice Site 154 991 5 24
ENSDART00000144542 Essential Splice Site 81 918 2 21
Genomic Location (Zv9):
Chromosome 12 (position 14354548)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13210201
GRCz11 12 13248504
KASP Assay ID:
2260-5101.1 (used for ordering genotyping assays)
KASP Sequence:
GATGATCAAGGCCAGAGAGATTGTGCCTGGWGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATT
Long Flanking Sequence:
TTCTCATCGCCAATGCTGTCGTTGGTGTGTGGCAGGTAACGCAAAAACACACACCAATAATTTATCACAGAAACAGAGGTTGCACTTTATTTTGATGGTTCATTTGTTGAATTTAAGTTATATTGCATCTACATGCCAATTAATTCTCATAAGACTATAGGTAGACTGATAGGGTTGGGGTTAGGGTTAGTGTAAGTTGACATGTACTTGCAAAGTTTCTTATAGTCAGTTAAATGTCTGTTGACATTGGCAGTGTCAACAGATTTTAAGCAGACAGTCTAGTAATGCTCAAATTGACCATCAAAATAAAGTGTTACCGCAACAGATACATGCAGATGATTGACAAATGTCTGCAACACAGGAGCGTAATGCAGAGAGCGCCATTGAGGCTCTGAAGGAGTATGAACCTGAGATGGGAAAGGTGTACCGCTCTGACAGGAAGAGTGTCCAGATGATCAAGGCCAGAGAGATTGTGCCTGGTGACATTGTGGAGGTGTCTG[G/A]TAAGACTCCTTTATGTCCTTCAGTCTTTGATTTGGAAAGGCGTTCTTATTATATTTTGAATACTTTTTGAAATTATTTATTACACCAAATCAACTTGAAATGCTTACATTTAGTGCTAAGGTTGATGTAGATGCGATACAACCGGGACGGATCCTAGCTGTTCAGATCAGTTGCTGTCTGTCTTGGTTATTGTAGAAAAAGAATAATTGTGGAGTAGTATCGTAAGATCTGATTTGCTTACTAAAACTATAATATTACTATATGACTATTAATATTGAATATGAACTATTAATCAAACTGGCCTTGCAAGATTTAAAGTCTTTGTGAAATAAAAATTTATATAACGCACATTGTTTTTCTTTACGACAACAATTTATCTGTGCAAGTTAATCCAATAAAAAGTGGCAGTGGAATGGCAGTCTTCTTTGTTGACATTAATTTGATGGCTTTATCCACAGTATTCTAAACTATACCCCTCTTACTGTTAGTTTGCTACTCAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3830
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 406 991 11 24
ENSDART00000144542 Nonsense 333 918 8 21
Genomic Location (Zv9):
Chromosome 12 (position 14359506)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13215159
GRCz11 12 13253462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCATATCATTTCTTCAGCACAAAGYTGGGTGCCAAAGTTGACTGCAGT[C/T]AATAWGAYGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAAYGAT
Long Flanking Sequence:
TAAATACAATTTATGCGACATGCCTTGAATGCACCATGAGAGCAAAAATCTGCAGGATACCGGTTCACCAGAATCTATTCATCAACTAAAATTGAGAAGTTACCTACTTGCAGTTTGAAAAGTACATATTTCTACAGTTCCCTACTTTTTTACAGTGCATATTTTTTTGCTGAATGAGGCCAGTGGTGTAGGAATTTCCTCTTTAAACATGGATACTGTTCTCTCATGTATGCTTTCATGCTGAAACTCACAGACTAAGATGAAATTCTGTATCGTTACAGATGTTCGTTATTGACAGAATTGATGGTGATCACGTTGAACTTGATAGCTTTGATATCTCTGGCTCCAAGTACACACCTGAGGGTGAGGTGTAAGTACACAGTTAAACTTCCTCTAAAATGCTTTGTTTAATTATCAGGCTAGCAGCATGTTCAAGTCATAAATGTAATCTGTCATATCATTTCTTCAGCACAAAGTTGGGTGCCAAAGTTGACTGCAGT[C/T]AATATGACGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAGGTGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTCTAAAAAAAATGTTATCATATTTGTCCACTGCTGCAGACCAAGAAGATCTATGAGAAGGTCGGTGAGGCCACTGAAACTGCTTTGTGCTGCTTGGTTGAGAAGATGAATGTTTTCAAGTCCAATGTCGGCAACCTGTCAAAGGTTGAGAGAGCAAATGCCTGCTGCAGTGTAAGTAGTGCTTTAAACCTTTCTAAACATCAGCAATGTAGCTTGACGCTGATATCTCTGTAACTATTTCCATTTTCATCTTGTGCAGGTTGTGAAGCAGCTTATGAAGAAGAACTTTACTCTGGAGTTCTCCCGTGACAGGAAATCCATGTCCGTGTATTGCACCCCTGTCAAGGGCGATGCAGGCAGCAAAATGTTTGTGAAGGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1409
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 407 991 11 24
ENSDART00000144542 Nonsense 334 918 8 21
Genomic Location (Zv9):
Chromosome 12 (position 14359511)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13215164
GRCz11 12 13253467
KASP Assay ID:
554-1330.1 (used for ordering genotyping assays)
KASP Sequence:
TATCATTTCTTCAGCACAAAGYTGGGTGCCAAAGTTGACTGCAGTCAATA[T/A]GAYGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAAYGATTCCTC
Long Flanking Sequence:
ACAATTTATGCGACATGCCTTGAATGCACCATGAGAGCAAAAATCTGCAGGATACCGGTTCACCAGAATCTATTCATCAACTAAAATTGAGAAGTTACCTACTTGCAGTTTGAAAAGTACATATTTCTACAGTTCCCTACTTTTTTACAGTGCATATTTTTTTGCTGAATGAGGCCAGTGGTGTAGGAATTTCCTCTTTAAACATGGATACTGTTCTCTCATGTATGCTTTCATGCTGAAACTCACAGACTAAGATGAAATTCTGTATCGTTACAGATGTTCGTTATTGACAGAATTGATGGTGATCACGTTGAACTTGATAGCTTTGATATCTCTGGCTCCAAGTACACACCTGAGGGTGAGGTGTAAGTACACAGTTAAACTTCCTCTAAAATGCTTTGTTTAATTATCAGGCTAGCAGCATGTTCAAGTCATAAATGTAATCTGTCATATCATTTCTTCAGCACAAAGTTGGGTGCCAAAGTTGACTGCAGTCAATA[T/A]GACGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAGGTGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTCTAAAAAAAATGTTATCATATTTGTCCACTGCTGCAGACCAAGAAGATCTATGAGAAGGTCGGTGAGGCCACTGAAACTGCTTTGTGCTGCTTGGTTGAGAAGATGAATGTTTTCAAGTCCAATGTCGGCAACCTGTCAAAGGTTGAGAGAGCAAATGCCTGCTGCAGTGTAAGTAGTGCTTTAAACCTTTCTAAACATCAGCAATGTAGCTTGACGCTGATATCTCTGTAACTATTTCCATTTTCATCTTGTGCAGGTTGTGAAGCAGCTTATGAAGAAGAACTTTACTCTGGAGTTCTCCCGTGACAGGAAATCCATGTCCGTGTATTGCACCCCTGTCAAGGGCGATGCAGGCAGCAAAATGTTTGTGAAGGTATTGTTTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45455
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 429 991 11 24
ENSDART00000144542 Essential Splice Site 356 918 8 21
Genomic Location (Zv9):
Chromosome 12 (position 14359578)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13215231
GRCz11 12 13253534
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAG[G/A]TGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTC
Long Flanking Sequence:
ATCTATTCATCAACTAAAATTGAGAAGTTACCTACTTGCAGTTTGAAAAGTACATATTTCTACAGTTCCCTACTTTTTTACAGTGCATATTTTTTTGCTGAATGAGGCCAGTGGTGTAGGAATTTCCTCTTTAAACATGGATACTGTTCTCTCATGTATGCTTTCATGCTGAAACTCACAGACTAAGATGAAATTCTGTATCGTTACAGATGTTCGTTATTGACAGAATTGATGGTGATCACGTTGAACTTGATAGCTTTGATATCTCTGGCTCCAAGTACACACCTGAGGGTGAGGTGTAAGTACACAGTTAAACTTCCTCTAAAATGCTTTGTTTAATTATCAGGCTAGCAGCATGTTCAAGTCATAAATGTAATCTGTCATATCATTTCTTCAGCACAAAGTTGGGTGCCAAAGTTGACTGCAGTCAATATGACGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAG[G/A]TGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTCTAAAAAAAATGTTATCATATTTGTCCACTGCTGCAGACCAAGAAGATCTATGAGAAGGTCGGTGAGGCCACTGAAACTGCTTTGTGCTGCTTGGTTGAGAAGATGAATGTTTTCAAGTCCAATGTCGGCAACCTGTCAAAGGTTGAGAGAGCAAATGCCTGCTGCAGTGTAAGTAGTGCTTTAAACCTTTCTAAACATCAGCAATGTAGCTTGACGCTGATATCTCTGTAACTATTTCCATTTTCATCTTGTGCAGGTTGTGAAGCAGCTTATGAAGAAGAACTTTACTCTGGAGTTCTCCCGTGACAGGAAATCCATGTCCGTGTATTGCACCCCTGTCAAGGGCGATGCAGGCAGCAAAATGTTTGTGAAGGTATTGTTTTCATTAAATCATCCTGTAATTTCTAGTGATCTCCGAATTCCATAATTTATAAATATGGTAATTTTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1049
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 434 991 12 24
ENSDART00000144542 Nonsense 361 918 9 21
Genomic Location (Zv9):
Chromosome 12 (position 14359679)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13215332
GRCz11 12 13253635
KASP Assay ID:
554-0952.1 (used for ordering genotyping assays)
KASP Sequence:
TAAAAAAAATGTTATCATATTTGTCCACTGCTGCAGACCAAGAAGATCTA[T/A]GAGAAGGTCGGTGRGGCCACTGAAACTGCTTTGTGCTGCTTGGTTGAGAA
Long Flanking Sequence:
ATGAGGCCAGTGGTGTAGGAATTTCCTCTTTAAACATGGATACTGTTCTCTCATGTATGCTTTCATGCTGAAACTCACAGACTAAGATGAAATTCTGTATCGTTACAGATGTTCGTTATTGACAGAATTGATGGTGATCACGTTGAACTTGATAGCTTTGATATCTCTGGCTCCAAGTACACACCTGAGGGTGAGGTGTAAGTACACAGTTAAACTTCCTCTAAAATGCTTTGTTTAATTATCAGGCTAGCAGCATGTTCAAGTCATAAATGTAATCTGTCATATCATTTCTTCAGCACAAAGTTGGGTGCCAAAGTTGACTGCAGTCAATATGACGGTTTAGTTGAGTTGGCCACCATCTGCGCCCTGTGCAATGATTCCTCCCTTGACTACAATGAGGTGAGAGATGTTCTTTCAAACTTCTATCGAAAGCTTTTATCCATATATGTCTAAAAAAAATGTTATCATATTTGTCCACTGCTGCAGACCAAGAAGATCTA[T/A]GAGAAGGTCGGTGAGGCCACTGAAACTGCTTTGTGCTGCTTGGTTGAGAAGATGAATGTTTTCAAGTCCAATGTCGGCAACCTGTCAAAGGTTGAGAGAGCAAATGCCTGCTGCAGTGTAAGTAGTGCTTTAAACCTTTCTAAACATCAGCAATGTAGCTTGACGCTGATATCTCTGTAACTATTTCCATTTTCATCTTGTGCAGGTTGTGAAGCAGCTTATGAAGAAGAACTTTACTCTGGAGTTCTCCCGTGACAGGAAATCCATGTCCGTGTATTGCACCCCTGTCAAGGGCGATGCAGGCAGCAAAATGTTTGTGAAGGTATTGTTTTCATTAAATCATCCTGTAATTTCTAGTGATCTCCGAATTCCATAATTTATAAATATGGTAATTTTTTACAAAATGTTGAAGTTCCCTTAATAATGAAAGTATTTCCTTGCTTTTCATTTGGTTAACATAGGGTGCTCCAGAGGGTGTGATTGACAGGTGTACCTATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Nonsense 829 991 18 24
ENSDART00000144542 Nonsense 756 918 15 21
Genomic Location (Zv9):
Chromosome 12 (position 14362596)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13218249
GRCz11 12 13256552
KASP Assay ID:
1641-0489.1 (used for ordering genotyping assays)
KASP Sequence:
ATCATGGGCAAACCTCCCCGCTCYCCCAAAGARCCCCTGATTTCTGGCTG[G/A]TTGTTCTTCAGATACATGACCGTTGGTGGTAGGTGTRCTTGTTANTTTTT
Long Flanking Sequence:
GGGCTCTGGCACTGCCGTTGCCAAGTCAGCCTCTGAGATGGTCCTGGCCGATGACAACTTTTCTTCTATTGTGGCTGCTGTTGAGGAAGGCAGAGCTATTTACAACAACATGAAGCAGTTCATTCGTTACCTGATTTCTTCCAACATTGGAGAAGTCGTCTGGTAAGAATCTTGGAAACAAGAAAGGCTTGTTTGAGAATCACTGATATAAACTTGTCTATTTAATCATTGTTCTGACACATCTTGACTGTTGTTATTAATGATTTTAGTTATTTATAGTTCTAATTCATGCTTGTCCATTTGTCATGTCTGTTCTCCTCTGATAGTATTTTCCTGACTGCTGCTCTTGGTCTGCCTGAGGCTCTGATCCCAGTCCAACTGCTGTGGGTGAACTTGGTGACAGATGGTCTGCCCGCCACTGCCCTGGGCTTTAACCCCCCTGATCTTGAGATCATGGGCAAACCTCCCCGCTCCCCCAAAGAACCCCTGATTTCTGGCTG[G/A]TTGTTCTTCAGATACATGACCGTTGGTGGTAGGTGTACTTGTTATTTTTTGTGGAATATCTTTAGTAACATTCTCTTTGGAGGTTTGAATAAACTGATTTCCCTCAGCCTATGTGGGTGCTGCCACTGTGGCCGCTGCTGCCTACTGGTTCATCTATGATGAGGAGGGTCCTCAGGTCACCTACTACCAGCTGGTGAGAAATATCTCCATCAATTTTATGAGTTTAAGCTAAGTCGCTTTAAGGCAATTCGTTTCACTCGGCGGCCATCTTTGAAACGGCTCTCGGGCATTCTTTCTGAAGCATTAAATTCTTACAATTACATTAGATATTTTGAACCACCAACCGTCTCATCAGGTTTTTAGTTTGCCCAAGCTAATGCACATGTGCACATGAAAGGAACGAGATCACGACACCAGTCTCATTTATGACCGTTCTACACATTATCATCTTCTGGTAATGATCGTCTGATCTTGCTGCTCTTCTGAAGTAATTCACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22052
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105896 Essential Splice Site 838 991 18 24
ENSDART00000144542 Essential Splice Site 765 918 15 21
Genomic Location (Zv9):
Chromosome 12 (position 14362625)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13218278
GRCz11 12 13256581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACCCCTGATTTCTGGCTGGTTGTTCTTCAGATACATGACCGTTGGTG[G/A]TAGGTGTACTTGTTATTTTTTGTGGAATATCTTTAGTAACATTCTCTTTG
Long Flanking Sequence:
CCTCTGAGATGGTCCTGGCCGATGACAACTTTTCTTCTATTGTGGCTGCTGTTGAGGAAGGCAGAGCTATTTACAACAACATGAAGCAGTTCATTCGTTACCTGATTTCTTCCAACATTGGAGAAGTCGTCTGGTAAGAATCTTGGAAACAAGAAAGGCTTGTTTGAGAATCACTGATATAAACTTGTCTATTTAATCATTGTTCTGACACATCTTGACTGTTGTTATTAATGATTTTAGTTATTTATAGTTCTAATTCATGCTTGTCCATTTGTCATGTCTGTTCTCCTCTGATAGTATTTTCCTGACTGCTGCTCTTGGTCTGCCTGAGGCTCTGATCCCAGTCCAACTGCTGTGGGTGAACTTGGTGACAGATGGTCTGCCCGCCACTGCCCTGGGCTTTAACCCCCCTGATCTTGAGATCATGGGCAAACCTCCCCGCTCCCCCAAAGAACCCCTGATTTCTGGCTGGTTGTTCTTCAGATACATGACCGTTGGTG[G/A]TAGGTGTACTTGTTATTTTTTGTGGAATATCTTTAGTAACATTCTCTTTGGAGGTTTGAATAAACTGATTTCCCTCAGCCTATGTGGGTGCTGCCACTGTGGCCGCTGCTGCCTACTGGTTCATCTATGATGAGGAGGGTCCTCAGGTCACCTACTACCAGCTGGTGAGAAATATCTCCATCAATTTTATGAGTTTAAGCTAAGTCGCTTTAAGGCAATTCGTTTCACTCGGCGGCCATCTTTGAAACGGCTCTCGGGCATTCTTTCTGAAGCATTAAATTCTTACAATTACATTAGATATTTTGAACCACCAACCGTCTCATCAGGTTTTTAGTTTGCCCAAGCTAATGCACATGTGCACATGAAAGGAACGAGATCACGACACCAGTCTCATTTATGACCGTTCTACACATTATCATCTTCTGGTAATGATCGTCTGATCTTGCTGCTCTTCTGAAGTAATTCACAAATTGGTTTTAATGGCGAATCTCTTCCAGAAA
Associated Phenotype:
Not determined