Busch Lab

ZMP

enc1

Ensembl ID:
ENSDARG00000035398
ZFIN ID:
ZDB-GENE-060531-140
Description:
Novel protein similar to vertebrate ectodermal-neural cortex (With BTB-like domain) (ENC1) [Source:U
Human Orthologue:
ENC1
Human Description:
ectodermal-neural cortex 1 (with BTB-like domain) [Source:HGNC Symbol;Acc:3345]
Mouse Orthologue:
Enc1
Mouse Description:
ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38486 Nonsense Mutation detected in F1 DNA Not yet available
sa9520 Nonsense Available for shipment Available now
sa6991 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38486
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 203 589 2 2
ENSDART00000141338 Nonsense 205 591 3 4
Genomic Location (Zv9):
Chromosome 5 (position 36242940)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34024889
GRCz11 5 34625042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGCTGCCCAAGGACATGCTGGTGCAACTTCTGGCACATGAAGAACTC[G/T]AAACAGAGGACGAGCGGCTAGTCTACGAGTCGGCGCTCAATTGGGTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 368 589 2 2
ENSDART00000141338 Nonsense 370 591 3 4
Genomic Location (Zv9):
Chromosome 5 (position 36243437)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34025386
GRCz11 5 34625539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGGTGTGTCCAAGGACGTTTGGGTGTACGATACATTACACGARGAATG[G/A]TCCAAGGCAGCTCCGATGTTGATAGCTCGTTTYGGTCATGGCTCGGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 406 589 2 2
ENSDART00000141338 Nonsense 408 591 3 4
Genomic Location (Zv9):
Chromosome 5 (position 36243550)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34025499
GRCz11 5 34625652
KASP Assay ID:
554-4749.1 (used for ordering genotyping assays)
KASP Sequence:
CCTGTATGTCGTCGGAGGTCAYACAGCTGCCACTGGCTGTCTGCCTGCAT[C/A]ACCATCTGTGTCCTTGAAGCAGGTAGAGCAGTTTGACCCAGTTGCTAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26516
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051293 Nonsense 478 589 2 2
ENSDART00000141338 Nonsense 480 591 3 4
Genomic Location (Zv9):
Chromosome 5 (position 36243767)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34025716
GRCz11 5 34625869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTGCTATGATCCCTCAGAAAATCGCTGGACGGTCCCAGCGTCCTG[T/A]CCGCAGCCGTGGCGATACACTGCAGCAGCTGTTCTAGGCAACCAGATCTT
Associated Phenotype:
Not determined