Busch Lab

ZMP

si:ch211-195c22.1

Ensembl ID:
ENSDARG00000035389
ZFIN IDs:
ZDB-GENE-050522-228, ZDB-GENE-060526-70
Description:
FCH domain only protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q502I9]
Human Orthologue:
FCHO2
Human Description:
FCH domain only 2 [Source:HGNC Symbol;Acc:25180]
Mouse Orthologue:
Fcho2
Mouse Description:
FCH domain only 2 Gene [Source:MGI Symbol;Acc:MGI:3505790]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33648 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26521
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051271 Essential Splice Site 12 848 2 27
ENSDART00000139673 None None 569 None 18
ENSDART00000141218 None None 299 None 8

The following transcripts of ENSDARG00000035389 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36804206)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34586155
GRCz11 5 35186308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGTGATCAAATGCAGTTGATTATAATTCAATTATGTTCTCTTTGGCA[G/T]GGCGATAAAAACAGTGGATTTTATGTCCTCTACCATAACATGAAACATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26520
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051271 Nonsense 19 848 2 27
ENSDART00000139673 None None 569 None 18
ENSDART00000141218 None None 299 None 8

The following transcripts of ENSDARG00000035389 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36804182)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34586131
GRCz11 5 35186284
KASP Assay ID:
2259-6135.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAATTCAATTATGTTCTCTTTGGCAGGGCGATAAAAACAGTGGATTTTA[T/A]GTCCTCTACCATAACATGAAACATGGCCAGATATCCAGCAAGGAGCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33648
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051271 Nonsense 200 848 6 27
ENSDART00000139673 None None 569 None 18
ENSDART00000141218 None None 299 None 8

The following transcripts of ENSDARG00000035389 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 36796161)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34578110
GRCz11 5 35178263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACGCCACTGCCAAGACTGAATTTGAGCAAAGAATGACAGAAACCGCA[C/T]AAGTAAGATGTGGTGGAGTGTGTTTGTTGGGGTCTGCGTTATGGGTGCAC
Associated Phenotype:
Not determined