Busch Lab

ZMP

tmem174

Ensembl ID:
ENSDARG00000035388
ZFIN ID:
ZDB-GENE-080819-2
Human Orthologue:
TMEM174
Human Description:
transmembrane protein 174 [Source:HGNC Symbol;Acc:28187]
Mouse Orthologue:
Tmem174
Mouse Description:
transmembrane protein 174 Gene [Source:MGI Symbol;Acc:MGI:1915594]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40487 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40487
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051297 Nonsense 239 247 4 4
Genomic Location (Zv9):
Chromosome 5 (position 36723022)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34504971
GRCz11 5 35105124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAGGGGAAAGCGGGTGCAGCAGACAGCGCCTCCTCTCCACCTGCATA[C/A]GAGGAGCTTTTCGCCACCTCATGTGACTCGTACTCCTGATTAACCAAATT
Associated Phenotype:
Not determined