Busch Lab

ZMP

TE2IP_DANRE

Ensembl ID:
ENSDARG00000035379
Description:
Telomeric repeat-binding factor 2-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYJ3]
Human Orthologue:
TERF2IP
Human Description:
telomeric repeat binding factor 2, interacting protein [Source:HGNC Symbol;Acc:19246]
Mouse Orthologue:
Terf2ip
Mouse Description:
telomeric repeat binding factor 2, interacting protein Gene [Source:MGI Symbol;Acc:MGI:1929871]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11124 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11124
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051258 None None 513 8 8
ENSDART00000051259 Nonsense 584 640 9 9
ENSDART00000127908 None None 512 None 8
Genomic Location (Zv9):
Chromosome 22 (position 37449608)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34624224
GRCz11 22 34599131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAGGTGACCAAGGCGCTGCTSAAAGCCAGTGGAGATCTTAAAAGAGCT[C/T]AGGTGTTTCTGCTAAATGGGTATGACCATGAGACRCACGGGCCTCTCTGG
Associated Phenotype:
Not determined