Busch Lab

ZMP

zgc:194261

Ensembl ID:
ENSDARG00000035340
ZFIN ID:
ZDB-GENE-080723-77
Description:
connexin 35-like [Source:RefSeq peptide;Acc:NP_001122238]
Human Orthologue:
GJD2
Human Description:
gap junction protein, delta 2, 36kDa [Source:HGNC Symbol;Acc:19154]
Mouse Orthologue:
Gjd2
Mouse Description:
gap junction protein, delta 2 Gene [Source:MGI Symbol;Acc:MGI:1334209]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40501 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40501
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040537 Nonsense 176 299 2 2
Genomic Location (Zv9):
Chromosome 5 (position 38596999)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36396683
GRCz11 5 36996836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTCCAAAAGTGCCAAGATCCGCCAGCAGGAAGGCATCTCCCGCTTCTA[T/A]GTCATCCAAGTGGTGTTCCGGAACGTTCTGGAAATCGGCTTTCTAGCCGG
Associated Phenotype:
Not determined