Busch Lab

ZMP

taf1

Ensembl ID:
ENSDARG00000035330
ZFIN ID:
ZDB-GENE-030131-5576
Description:
transcription initiation factor TFIID subunit 1 [Source:RefSeq peptide;Acc:NP_001038250]
Human Orthologues:
TAF1, TAF1L
Human Descriptions:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like [Source:HGNC S
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf1
Mouse Description:
TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Acc

Alleles

There are 14 alleles of this gene:

Allele Name Consequence Status Availability
sa20476 Nonsense Available for shipment Available now
sa10523 Essential Splice Site Available for shipment Available now
sa40499 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20475 Nonsense Available for shipment Available now
sa40498 Nonsense Mutation detected in F1 DNA Not yet available
sa33651 Nonsense Mutation detected in F1 DNA Not yet available
sa40497 Nonsense Mutation detected in F1 DNA Not yet available
sa1937 Essential Splice Site Available for shipment Available now
sa40496 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15367 Nonsense Available for shipment Available now
sa26522 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40495 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 52 1947 3 40
ENSDART00000123402 Nonsense 52 587 3 13
ENSDART00000126927 Nonsense 52 369 3 10
ENSDART00000130225 Nonsense 52 1910 2 43
Genomic Location (Zv9):
Chromosome 5 (position 38189781)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35989465
GRCz11 5 36589618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCTCTCAGGAGTCAAAGAAGCATTTGGCTGGTCTGGGAACGCTGGGTT[T/A]GGGTTCACTCATTACAGAGATCACAGCCAGCGAGGAGGAAACAGCCGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10523
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 793 1947 16 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 785 1910 16 43
Genomic Location (Zv9):
Chromosome 5 (position 38183117)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35982801
GRCz11 5 36582954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACAYTTCACCATTCCTTGGATCATTGCACCCTGGACAGCTGCTACAGG[T/C]AACAYACACAGTTGCACAGTTCTGTCATCCTCTATTTTAAGATCTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40499
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 978 1947 20 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 970 1910 20 43
Genomic Location (Zv9):
Chromosome 5 (position 38178360)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35978044
GRCz11 5 36578197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCGAGGAAGAGAATGAGGAGGAATTCCAGATGAAGATTGACGATGAGG[T/G]CAGAGAATGAGGAGTACATTTGAATACTGTATTTGTGCAGTTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2272
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1068 1947 22 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1060 1910 22 43
Genomic Location (Zv9):
Chromosome 5 (position 38177893)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35977577
GRCz11 5 36577730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAAATGCCAAGCAGTTGCTTCGCAAGTTTGGGGTTCCTGAAGAAGAGG[T/C]GAGACTAACCCAACAAACTAATMRAAGATACAAGATCATAGATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1088 1947 23 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1080 1910 23 43
Genomic Location (Zv9):
Chromosome 5 (position 38177690)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35977374
GRCz11 5 36577527
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGTCCCGTTGGGAGGTTATCGATGTCGTGAGGACCATGTCTACTGAG[C/T]AGGCTCGTTCAGGGGAAGGACCAATGAGTAAATTTGCTCGTGGGTCTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1234 1947 25 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1214 1910 26 43
Genomic Location (Zv9):
Chromosome 5 (position 38168521)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35968205
GRCz11 5 36568358
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGTCACTAGTCTGAACTCCTCAGCAACAGGGCGAAGGCTGAAAATCTA[T/A]CGCACCTTTTGTGATGAGGATGGCAAGGAGTATGTGCGCTGCGAGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33651
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1350 1947 27 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1330 1910 28 43
Genomic Location (Zv9):
Chromosome 5 (position 38167903)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35967587
GRCz11 5 36567740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGTGCAATTGGCCATATGAGAACCAACAAGTTTTGCCCGCTGTACTAC[C/T]AAACCAATGCTCCCCCCTCCAATCCGGTGGCTATGACAGAGGAACAGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26523
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1434 1947 28 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1414 1910 29 43
Genomic Location (Zv9):
Chromosome 5 (position 38166013)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35965697
GRCz11 5 36565850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAAAGAAGAGGCGTGTGGGGACAACGGTGCACTGTGACTACCTCAATG[T/A]AAGAGTATGTTTTAAGTGCTTTTTTTATACAGTAATAGTTAATCACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40497
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1508 1947 30 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1488 1910 31 43
Genomic Location (Zv9):
Chromosome 5 (position 38165575)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35965259
GRCz11 5 36565412
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATTTGCAGACGTTACGTGAAAACGTTCGCAAGCGCATGTACCCTTCA[C/T]GAGAGGAGTTCAGAGAAAGCGTTGAGCTCATCTTCAAAAACAGTGCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1937
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
Genomic Location (Zv9):
Chromosome 5 (position 38163536)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35963220
GRCz11 5 36563373
KASP Assay ID:
554-1925.1 (used for ordering genotyping assays)
KASP Sequence:
CTATTATAAAGTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGG[T/G]CAGGAAGATCTGTGTGTGGACACAGTAAACTTCAGTTGTAGTTTAGGTCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40496
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
ENSDART00000051196 Essential Splice Site 1621 1947 33 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1601 1910 34 43
Genomic Location (Zv9):
Chromosome 5 (position 38163536)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35963220
GRCz11 5 36563373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATTATAAAGTCATCATCAACCCCATGGATCTGGACACACTCCGTAAGG[T/C]CAGGAAGATCTGTGTGTGGACACAGTAAACTTCAGTTGTAGTTTAGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15367
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1668 1947 35 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1648 1910 36 43
Genomic Location (Zv9):
Chromosome 5 (position 38163215)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35962899
GRCz11 5 36563052
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGATAGTCCTTATACAAAAACTGCTCTGGAAATTGTGAAMGTTTGCAAG[C/T]AGACTTTAGCGGAGGTGAGTCTGTGTGAGAGTCAGAGCTCTTTGTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26522
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 None None 1947 None 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Essential Splice Site 1724 1910 39 43
Genomic Location (Zv9):
Chromosome 5 (position 38160570)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35960254
GRCz11 5 36560407
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACACACAAACCCTTAGTCCAAGGTTCTTTATTAAGAGGATCCTCAGTT[A/G]CTTTTTTCACGTGTTATTGTATGATTTAATTAATTATAATTTTTTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40495
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051196 Nonsense 1810 1947 38 40
ENSDART00000123402 None None 587 None 13
ENSDART00000126927 None None 369 None 10
ENSDART00000130225 Nonsense 1790 1910 40 43
Genomic Location (Zv9):
Chromosome 5 (position 38158441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35958125
GRCz11 5 36558278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTACCAGGATCTGCTGATGTCAGATGCTGAAGATGATGCCAGTGAG[G/T]AGGAAGGCGATAATCCATTCTCCTGTAAGTGTATGCTTGAGTATTTGTGC
Associated Phenotype:
Not determined