Busch Lab

ZMP

si:ch211-149m3.3

Ensembl ID:
ENSDARG00000035308
ZFIN IDs:
ZDB-GENE-091020-12, ZDB-GENE-100921-32
Human Orthologue:
GRB10
Human Description:
growth factor receptor-bound protein 10 [Source:HGNC Symbol;Acc:4564]
Mouse Orthologue:
Grb10
Mouse Description:
growth factor receptor bound protein 10 Gene [Source:MGI Symbol;Acc:MGI:103232]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa19132 Nonsense Mutation detected in F1 DNA Not yet available
sa22755 Nonsense Available for shipment Available now
sa18384 Nonsense Available for shipment Available now
sa42661 Nonsense Mutation detected in F1 DNA Not yet available
sa22754 Nonsense Available for shipment Available now
sa36043 Nonsense Mutation detected in F1 DNA Not yet available
sa17433 Nonsense Available for shipment Available now
sa42660 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19132
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 9 594 1 16
ENSDART00000137365 None None 578 None 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9780100)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8566039
GRCz11 16 8479768
KASP Assay ID:
2260-9220.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGACACTAACAGAACGTGTATCATGGCTGTGGCCGGATGTCCGGATTA[T/A]TTTCTACACCATCCAAATTACAAGGTAGAAATTATTTTAATTTTTATTAA
Long Flanking Sequence:
TAATCTTACCCTCTGAAAATAAGGTACCATTATACGAGTGAAAATATATAATTTTGGTCTCGGTGGAAATGTTCACTATTTGGAGCTCCGTATGATTTGTTTGTTTAACATGTTCCTACTCTCCTCATATTGCAAGTGGAGCTGCTTTCCCAGTGTCTTGGGTTTTAAAAGCACAATCTAGAGATGGTTTCATATATTTTAACTGTGTGGCTGTCGGTCAGCTTTGGATTCAGTATTTTCCTGTTCGTATTCTTATGTTGTTTACTGACCCTGTGGAACTATTTGGGTTAAGATGTGCTCTGTGCTATATTGGTAGTAGCCACTTAGACTCAACTAATAAAGAGATTGCGTTTTTTTTTTTACCTTGAAAAACATTTGATGTAACATTTTTGTTTTGGTTTAATTTCAGACGCTTTTCCTCATCTATCTGAGGTGGATGTGATATCCGAGAGAGACACTAACAGAACGTGTATCATGGCTGTGGCCGGATGTCCGGATTA[T/A]TTTCTACACCATCCAAATTACAAGGTAGAAATTATTTTAATTTTTATTAATACGTTATTTACTCAGCCTTTATATTATCATTGTCACTTCACTTATTTTTGTGTCTGTATTATGTGAACTAGAGTTATTTCATAAACTGCTACAGTCAACCCTGTATAACCTTAAAGCGTAATGATGAAGGAACAATTATTATTTACTAAATCAGTGCATTGTCAAGAAATATTTGAATATGTTTTGAATATATGATTGTTTTTTTTTATCATATTTCCTTTCTTTTTCTGAATAGTTTTAATAATTAAAAAGTGTTTTTAATATTGTTATATTTGCAACCATATGAATGTAAAGTTTAAGGGAGCACACTTGTCAATATGAAGATCGCTGAAACTGAACTGTAAAAATATTTGAAAGCAAAGTACACTTTAAAGAGATGACTTTCATGTTTTATTTTTTGCTTTTAAAATCATTCTGAGTTTAAATGTTAGAATGTTCTAAACGAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22755
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 191 594 5 16
ENSDART00000137365 Nonsense 176 578 4 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9694813)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8480752
GRCz11 16 8394481
KASP Assay ID:
2260-9219.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTG[C/A]CAGTTTCTCGTCTATAAAAACCATTGTGTGGACGATAACAGTTGGGCGCT
Long Flanking Sequence:
AGAACGTATGAAAGGTCTCAGAATTTTCGAGAAGAGCTAGAATGTGTGTGAGGAAGGGGGCACAATGACACGGGACACATTTCAAACTGTTTCAAATGAAATGCTTCTCTTTAGCTTCTCCCTCACATCAGTGAGGATGTAGTCTAGACATGGAATTTGCATGATAAGACCTAGATTTGAGCATTAATGGATTTGCACTACGACCCAAAGCCTTAAAAGAGTTTCTTTTTGCTTAAAGGTACGGTATCGTAACATCACATAAAATACCGATTGATTCATTTTGGGGCTCTGAAGATAAAATTTGTCCTGTGACGCAGTACACTTTTCTCCTGTCTAAATGTGATTTTTTTTTTCCATACTAGGAATTTTAGCTGTTTAAAACGAACCTCGAAGACATCTAATTTTTGTTGTTTTCTGTTTCAGATTATAAAAATATTCAGCGAGGACGGGATGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTG[C/A]CAGTTTCTCGTCTATAAAAACCATTGTGTGGACGATAACAGTTGGGCGCTTGTGGAGCATCATCCAGCCCTGGGACTCGGTAACTAGCTTGCTCCTTTTCCAAGCTTGAGTGTAGCGAGTAAATTTATAGAGCTGTTTGAAAGTGTCTGTGTGTGTGCGTCAACCACTTTAGATGCACTAATTACAGGGTCTTTTGTGCTGGAGTTGAAATCAATGATGACCATGTAAGAGAAGAAGACAGACTTCCTTGATTCATGCTTTTATGTCTTCGGGCTGGGAGTAATTGATTACCAGTCGCCGGGGGGAAATCCCATATAATGAAGAGGCATAACAGGAAGTTAGGTTCCCTAAGAGTTGAAGTGCTTCCTTAAAGTTGAGCATTGTCATCATTTGTTACGTGCTATTGAGAGCGGTTTTCAGTGCGACTCATCTCTGCATCAAACCTGTTAAACTCGTTAATCCTAAACTATTGGATTTCAATTGCGTGCTTGGTTGATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18384
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 192 594 5 16
ENSDART00000137365 Nonsense 177 578 4 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9694812)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8480751
GRCz11 16 8394480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTGC[C/T]AGTTTCTCGTCTATAAAAACCATTGTGTGGACGAYAACAGYTGGGCGCTT
Long Flanking Sequence:
GAACGTATGAAAGGTCTCAGAATTTTCGAGAAGAGCTAGAATGTGTGTGAGGAAGGGGGCACAATGACACGGGACACATTTCAAACTGTTTCAAATGAAATGCTTCTCTTTAGCTTCTCCCTCACATCAGTGAGGATGTAGTCTAGACATGGAATTTGCATGATAAGACCTAGATTTGAGCATTAATGGATTTGCACTACGACCCAAAGCCTTAAAAGAGTTTCTTTTTGCTTAAAGGTACGGTATCGTAACATCACATAAAATACCGATTGATTCATTTTGGGGCTCTGAAGATAAAATTTGTCCTGTGACGCAGTACACTTTTCTCCTGTCTAAATGTGATTTTTTTTTTCCATACTAGGAATTTTAGCTGTTTAAAACGAACCTCGAAGACATCTAATTTTTGTTGTTTTCTGTTTCAGATTATAAAAATATTCAGCGAGGACGGGATGGGAAAGGTGGTGGAGATCCCAGCCGACATGACGGCGCGAGACCTGTGC[C/T]AGTTTCTCGTCTATAAAAACCATTGTGTGGACGATAACAGTTGGGCGCTTGTGGAGCATCATCCAGCCCTGGGACTCGGTAACTAGCTTGCTCCTTTTCCAAGCTTGAGTGTAGCGAGTAAATTTATAGAGCTGTTTGAAAGTGTCTGTGTGTGTGCGTCAACCACTTTAGATGCACTAATTACAGGGTCTTTTGTGCTGGAGTTGAAATCAATGATGACCATGTAAGAGAAGAAGACAGACTTCCTTGATTCATGCTTTTATGTCTTCGGGCTGGGAGTAATTGATTACCAGTCGCCGGGGGGAAATCCCATATAATGAAGAGGCATAACAGGAAGTTAGGTTCCCTAAGAGTTGAAGTGCTTCCTTAAAGTTGAGCATTGTCATCATTTGTTACGTGCTATTGAGAGCGGTTTTCAGTGCGACTCATCTCTGCATCAAACCTGTTAAACTCGTTAATCCTAAACTATTGGATTTCAATTGCGTGCTTGGTTGATTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42661
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 284 594 8 16
ENSDART00000137365 Nonsense 269 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679544)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465483
GRCz11 16 8379212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATCTGTGTGTTTTATTGAATCCATCTTCTTTCATCACCAGAACTTCT[T/A]GAACTCCAGCAGTTGTCCTGAGATCCAGGGATATTTGTATGTGAAAGAGA
Long Flanking Sequence:
TGGTGGTTCATTTCACTGTGGTGACCTCTGAAATACAGACTAAAGGAAATGATTGAGTTACATTGAGCTAACAATGAACAGCTTTATTCTCATTAACTAATGTTAACAAACAGGAATAAATTCTGTAATAAATGTATTTTTCATTGTTTGATTGTGTTTAGCTAACATTATCTAATACAGCATTATTGTTAAGTGTTACCATTTTATTTACAATACATAATATTTGTGTTTAAAAAGAATTTACCTACATATTCATAAGATTGTCTTATTTAATCTTTTATTAATGGATGAACTGATGTTAGATCAAAATGTTGCTAAATTTGACATGCAGGTCAGTATTTTTTGGGAAAAAAAAAACTTTTAATCAGTGATTTGTTGCTCCATTCAGATTTCAAAAAACTTCAACTGGTGGTGAAGAGTTCACATTGAAACGAATCAATCCACTGCAATCTTATCTGTGTGTTTTATTGAATCCATCTTCTTTCATCACCAGAACTTCT[T/A]GAACTCCAGCAGTTGTCCTGAGATCCAGGGATATTTGTATGTGAAAGAGATGGGCAGGAAATCGTGGAAGAAACTGTATGTGTTTTTAAGACGGTCAGGGTTGTATTTTTCGACGAAAGGAACGTCAAAGGTAAGTTAACTTCTATAAAAGTTAGTAAAAAAAAAAACAATCTTTAACTGCCTGCTCTACCAAAAGGAGGACCATATTTTGACTGTTTTCAATAATGACTGTTAAATAATGGTTTACACACAGCATTGTTGGTTTACAAAAAAATAAATAAAATCTAACATAATCCTGTTGCACTTGTAACAGGGTTATATTGTATCTCTCCACTTGCAAACATTGAAATACTAATGGAAAGGAAGGGGTTAACATTTGTTTTATTGTTTTACATGTAGAGCGCCCCCTCTGTTACCTTAAAAAGAAAATTCATTGTAGTATATATAAGAGGAAGCCAGTGCATGAGGCTGGTTGAATAGATCTGCGCTCATTTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22754
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 310 594 8 16
ENSDART00000137365 Nonsense 295 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679465)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465404
GRCz11 16 8379133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATATTTGTATGTGAAAGAGATGGGCAGGAAATCGTGGAAGAAACTGTA[T/A]GTGTTTTTAAGACGGTCAGGGTTGTATTTTTCGACGAAAGGAACGTCAAA
Long Flanking Sequence:
AGCTTTATTCTCATTAACTAATGTTAACAAACAGGAATAAATTCTGTAATAAATGTATTTTTCATTGTTTGATTGTGTTTAGCTAACATTATCTAATACAGCATTATTGTTAAGTGTTACCATTTTATTTACAATACATAATATTTGTGTTTAAAAAGAATTTACCTACATATTCATAAGATTGTCTTATTTAATCTTTTATTAATGGATGAACTGATGTTAGATCAAAATGTTGCTAAATTTGACATGCAGGTCAGTATTTTTTGGGAAAAAAAAAACTTTTAATCAGTGATTTGTTGCTCCATTCAGATTTCAAAAAACTTCAACTGGTGGTGAAGAGTTCACATTGAAACGAATCAATCCACTGCAATCTTATCTGTGTGTTTTATTGAATCCATCTTCTTTCATCACCAGAACTTCTTGAACTCCAGCAGTTGTCCTGAGATCCAGGGATATTTGTATGTGAAAGAGATGGGCAGGAAATCGTGGAAGAAACTGTA[T/A]GTGTTTTTAAGACGGTCAGGGTTGTATTTTTCGACGAAAGGAACGTCAAAGGTAAGTTAACTTCTATAAAAGTTAGTAAAAAAAAAAACAATCTTTAACTGCCTGCTCTACCAAAAGGAGGACCATATTTTGACTGTTTTCAATAATGACTGTTAAATAATGGTTTACACACAGCATTGTTGGTTTACAAAAAAATAAATAAAATCTAACATAATCCTGTTGCACTTGTAACAGGGTTATATTGTATCTCTCCACTTGCAAACATTGAAATACTAATGGAAAGGAAGGGGTTAACATTTGTTTTATTGTTTTACATGTAGAGCGCCCCCTCTGTTACCTTAAAAAGAAAATTCATTGTAGTATATATAAGAGGAAGCCAGTGCATGAGGCTGGTTGAATAGATCTGCGCTCATTTTTGTGTTCTGACTGTTTTCACAACAATAAATCGATTAAAGACATATTAAAGTGAATATTTATTTATACAACGCAGAAGAGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 319 594 8 16
ENSDART00000137365 Nonsense 304 578 7 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9679438)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8465377
GRCz11 16 8379106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAAATCGTGGAAGAAACTGTATGTGTTTTTAAGACGGTCAGGGTTGTA[T/A]TTTTCGACGAAAGGAACGTCAAAGGTAAGTTAACTTCTATAAAAGTTAGT
Long Flanking Sequence:
CAAACAGGAATAAATTCTGTAATAAATGTATTTTTCATTGTTTGATTGTGTTTAGCTAACATTATCTAATACAGCATTATTGTTAAGTGTTACCATTTTATTTACAATACATAATATTTGTGTTTAAAAAGAATTTACCTACATATTCATAAGATTGTCTTATTTAATCTTTTATTAATGGATGAACTGATGTTAGATCAAAATGTTGCTAAATTTGACATGCAGGTCAGTATTTTTTGGGAAAAAAAAAACTTTTAATCAGTGATTTGTTGCTCCATTCAGATTTCAAAAAACTTCAACTGGTGGTGAAGAGTTCACATTGAAACGAATCAATCCACTGCAATCTTATCTGTGTGTTTTATTGAATCCATCTTCTTTCATCACCAGAACTTCTTGAACTCCAGCAGTTGTCCTGAGATCCAGGGATATTTGTATGTGAAAGAGATGGGCAGGAAATCGTGGAAGAAACTGTATGTGTTTTTAAGACGGTCAGGGTTGTA[T/A]TTTTCGACGAAAGGAACGTCAAAGGTAAGTTAACTTCTATAAAAGTTAGTAAAAAAAAAAACAATCTTTAACTGCCTGCTCTACCAAAAGGAGGACCATATTTTGACTGTTTTCAATAATGACTGTTAAATAATGGTTTACACACAGCATTGTTGGTTTACAAAAAAATAAATAAAATCTAACATAATCCTGTTGCACTTGTAACAGGGTTATATTGTATCTCTCCACTTGCAAACATTGAAATACTAATGGAAAGGAAGGGGTTAACATTTGTTTTATTGTTTTACATGTAGAGCGCCCCCTCTGTTACCTTAAAAAGAAAATTCATTGTAGTATATATAAGAGGAAGCCAGTGCATGAGGCTGGTTGAATAGATCTGCGCTCATTTTTGTGTTCTGACTGTTTTCACAACAATAAATCGATTAAAGACATATTAAAGTGAATATTTATTTATACAACGCAGAAGAGATGCAAAAGACTAGTTACATTGGTGCCGTGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28583
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 411 594 11 16
ENSDART00000137365 Nonsense 396 578 10 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9673324)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8459263
GRCz11 16 8372992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCACTATAGTATGGAATTTTACTCTATCAAAATTACAAGATCCACCAG[C/T]AGAGAAAAACGTTGCTTTCACACTTCTCAGCGCCTGTGGTAAGACTCCTT
Long Flanking Sequence:
AAATTACACCCGTTACCGACCGCTCCTGCCGAACAGATGTTGCAATTTAACTACTTTCCAATCCAAAATAAAAACAACAAAAATATCAATGTCTAAAAATGTTACAGCTTGACGTTGTGTGGACGTTACCAAAATGAAGTCTATCAGATGTCTATTGGACGTCAAAATAACCTTGTCCTTAGATGCTGACGACCTTAATCTAATATTAATGTCTTGTGATACTGTCTGTCTGCTGGGATGCTTCACATCCAGCATTACACTTTCTCTAGTCTGATCTAGAACGAGCTTCTTTACTTTTTCCGATTCAGGAAATGAACTCTTTCCATGAAACATTTTGTTCCTTATCTAGAACCCCCACCATCCTCTTTTTGTTGTACAAATGTATTTTAGTGCTTTCCTAAAGAGCATAATATGTTTTTCAACTCGGGAACACTTTTTTTTCTCTCCTTTCTTCACTATAGTATGGAATTTTACTCTATCAAAATTACAAGATCCACCAG[C/T]AGAGAAAAACGTTGCTTTCACACTTCTCAGCGCCTGTGGTAAGACTCCTTTGAACCTACTCCTGCATTCAGTTTCTGTACCTCACAGATGGAGCATTAATCACACGTGTCAGTATGTGGGCCATGATGTCACATTATGGAATGATTGTTCGAGTGTTGGCAGTAAAGTTATTATTACAGCTTGTTCTATGGATATTATGCAGCGATTCTATAATAAATGAGCACAGAGATGCAAAATATGTCTGCATTTAGCATGCATGTTTTGATATGTGTAAATGTTTTTAGTATTGCACGACTCTTTATATTCTATATTTAATCTACTGCCATATGATCGAATGTACTGTAAATGGAAGAGTAGAAGACATAAGAGACTAGATCATTGTCATAAGACAACACACCTGCAACAAAGCAAACAAAGTCATTGTCACTGTGTGATCTTATTTTCCAGAGGAGTGTTTCAGAGAGCTCTCTGGTTGCCATGGATTTCTCAGGGAGGATAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17433
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 461 594 12 16
ENSDART00000137365 Nonsense 446 578 11 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9672764)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8458703
GRCz11 16 8372432
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGACAATCCTKTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCT[G/A]GAGAGTGAGTTACAATAATATTTTTTGGTCATTTAARTTACATGTTARAA
Long Flanking Sequence:
TCCTGCATTCAGTTTCTGTACCTCACAGATGGAGCATTAATCACACGTGTCAGTATGTGGGCCATGATGTCACATTATGGAATGATTGTTCGAGTGTTGGCAGTAAAGTTATTATTACAGCTTGTTCTATGGATATTATGCAGCGATTCTATAATAAATGAGCACAGAGATGCAAAATATGTCTGCATTTAGCATGCATGTTTTGATATGTGTAAATGTTTTTAGTATTGCACGACTCTTTATATTCTATATTTAATCTACTGCCATATGATCGAATGTACTGTAAATGGAAGAGTAGAAGACATAAGAGACTAGATCATTGTCATAAGACAACACACCTGCAACAAAGCAAACAAAGTCATTGTCACTGTGTGATCTTATTTTCCAGAGGAGTGTTTCAGAGAGCTCTCTGGTTGCCATGGATTTCTCAGGGAGGATAGGCAGAGTGATCGACAATCCTGTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCT[G/A]GAGAGTGAGTTACAATAATATTTTTTGGTCATTTAAGTTACATGTTAAAAAAACACTCCACTTTTTTTGGAAATAAGCTCATTTTTTTCAACTACCCTAGAGTATAACAGTATAAAAGGACATTTGCCCTGCTGAAAAATCCAGCTTAAACCAGCCTAGGCTGGTTGGCTGTTTTTTTGCTGGTCAACCAGGCTGGTTTTAGAGGGGTTTTGGCCATATTCAGGCTGCTTTCCAGTCATTTCCAGCCTGGTCTTAGCTGGTCAGACTAGAAAATGACCTGCTAAATCCAGCTAAAACCAGCTTGACCAGCCTGGTTTAAGCTGGAAATAGCTGGTTTTGACTGGACTCCCAGCCTGGCTAGGCTAGTCAAGTTGGTTTTAGCTGGTCATTTCCCAGCCTGACCAGCTAACACCAGGCTGGAGATGACTGGAAACCAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGGCTGGTCGACAAGCTAATACCGGTCAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42660
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Nonsense 462 594 12 16
ENSDART00000137365 Nonsense 447 578 11 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9672762)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8458701
GRCz11 16 8372430
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAATCCTGTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCTGG[A/T]GAGTGAGTTACAATAATATTTTTTGGTCATTTAAGTTACATGTTAAAAAA
Long Flanking Sequence:
CTGCATTCAGTTTCTGTACCTCACAGATGGAGCATTAATCACACGTGTCAGTATGTGGGCCATGATGTCACATTATGGAATGATTGTTCGAGTGTTGGCAGTAAAGTTATTATTACAGCTTGTTCTATGGATATTATGCAGCGATTCTATAATAAATGAGCACAGAGATGCAAAATATGTCTGCATTTAGCATGCATGTTTTGATATGTGTAAATGTTTTTAGTATTGCACGACTCTTTATATTCTATATTTAATCTACTGCCATATGATCGAATGTACTGTAAATGGAAGAGTAGAAGACATAAGAGACTAGATCATTGTCATAAGACAACACACCTGCAACAAAGCAAACAAAGTCATTGTCACTGTGTGATCTTATTTTCCAGAGGAGTGTTTCAGAGAGCTCTCTGGTTGCCATGGATTTCTCAGGGAGGATAGGCAGAGTGATCGACAATCCTGTGGAGGCACAGAGTGCTGCCATGGAGGAGGGACATGCCTGG[A/T]GAGTGAGTTACAATAATATTTTTTGGTCATTTAAGTTACATGTTAAAAAAACACTCCACTTTTTTTGGAAATAAGCTCATTTTTTTCAACTACCCTAGAGTATAACAGTATAAAAGGACATTTGCCCTGCTGAAAAATCCAGCTTAAACCAGCCTAGGCTGGTTGGCTGTTTTTTTGCTGGTCAACCAGGCTGGTTTTAGAGGGGTTTTGGCCATATTCAGGCTGCTTTCCAGTCATTTCCAGCCTGGTCTTAGCTGGTCAGACTAGAAAATGACCTGCTAAATCCAGCTAAAACCAGCTTGACCAGCCTGGTTTAAGCTGGAAATAGCTGGTTTTGACTGGACTCCCAGCCTGGCTAGGCTAGTCAAGTTGGTTTTAGCTGGTCATTTCCCAGCCTGACCAGCTAACACCAGGCTGGAGATGACTGGAAACCAGCCTGGAAATGGCCAAAACCCCTCTAAAACCAGGCTGGTCGACAAGCTAATACCGGTCAACCAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19131
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051166 Essential Splice Site 515 594 14 16
ENSDART00000137365 Essential Splice Site 499 578 13 15

The following transcripts of ENSDARG00000035308 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9670389)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8456328
GRCz11 16 8370057
KASP Assay ID:
2260-9214.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGGGAAGAATCCCACAAGCTGATCCATCAGCAGGGCAGAGTGGATGGG[T/G]ACATATCATAGCATCTCATTAGTTATTCTCAAAAAAACATGCTGGTTGAT
Long Flanking Sequence:
AAAAATCTAAAACTTTAAAGATTGACATTATATTTGTTTTTATCTTACCTAAAATGTCTGACAGTTGAATGCTTAATGGATCCAATCCATATTCGCTAAAACCAATTTAACGAAGAAAAAAGCTAGCACTATAATGCTGTATGCAACTAACCAGTATCTGTATGAGGGTCTCCACAATTGTTTTTGTTAAAATTGGTATCGGCTCAAAAAAATCTATGCATCCCTAATAAAAAGATTAAAACAATTGTACTTTGCTGTCTTAAAGTCATGCAGATTAAATTCTGTAATTTAAAGGTATACATCACAGTACATTCTTTTGAAGGATAGATGGCATGGCACTGACTATGCTGAGCATTAGAGAGATGCACATTCCCCTTGTCTTAAAGGCATTCTCTATCACTTCTTATCCAGTTATCCACAGAACTCAGCTGTGGTTTCACGGTCGTATTTCACGGGAAGAATCCCACAAGCTGATCCATCAGCAGGGCAGAGTGGATGGG[T/G]ACATATCATAGCATCTCATTAGTTATTCTCAAAAAAACATGCTGGTTGATTCTCTTGACTGTGCGATAGATACTTCAACGTGACTTTTTTTGTGCTACAGAATGTTTCTCCTGAGGGACAGCCAGAGCAATCCTAAGGCGTTTGTACTTACACTGTGTCACCACCAGAAAATCAAACATTTTCAAATATTGCTGGTAAGATTTGATCATTTCATTCACACACAGCATGTTTACTTGCTTATACCTTTTAGTGAAGCATAGAGAGAATTATTAAAGGAAGGCTCCTCTAGAGTTAAACTGATGAGTTTTACCATTTTTAATCCATTCAGCCGATCTCTGGGTCTAGCGAGAGCACTTTTAGCTTAGCTTAGCTTAGCACAAATAATTAAATCAGACTACACCATTAGCGATTTGCTTAAAACATAAAAAAAAAGACATTTTCCTATGTAACTCTTCTGCTGTTACATTGTGTACTAAAACCGACAGAAAATGAAAGTTGCT
Associated Phenotype:
Not determined