Busch Lab

ZMP

dmrt3a

Ensembl ID:
ENSDARG00000035290
ZFIN IDs:
ZDB-GENE-021220-3, ZDB-GENE-021220-5
Description:
Doublesex- and mab-3-related transcription factor 3a [Source:UniProtKB/Swiss-Prot;Acc:P83758]
Human Orthologue:
DMRT3
Human Description:
doublesex and mab-3 related transcription factor 3 [Source:HGNC Symbol;Acc:13909]
Mouse Orthologue:
Dmrt3
Mouse Description:
doublesex and mab-3 related transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:2449470]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40540 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40540
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051146 Essential Splice Site 127 448 1 2
Genomic Location (Zv9):
Chromosome 5 (position 46619765)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44401030
GRCz11 5 45001183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATAGACCTGCGCTGGAACACAGAGACCGGGACCCCCAAAACACCGCAAG[G/T]TAACCGCTTTCTCAGTATTTGAAAAAGTTTACTGATTGGAATTAAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15557
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051146 Nonsense 376 448 2 2
Genomic Location (Zv9):
Chromosome 5 (position 46621857)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44403122
GRCz11 5 45003275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCACAATGATGTGACTCTGTGGAATACCATGACATTGCAGCAGCAGTA[T/A]CAGCTGCGCTCTCAGTAYGTCCCGCCATTCTCAGGMCCCTCAGCCGGGGT
Associated Phenotype:
Not determined