Busch Lab

ZMP

npr3

Ensembl ID:
ENSDARG00000035253
ZFIN ID:
ZDB-GENE-060531-91
Description:
atrial natriuretic peptide receptor 3 [Source:RefSeq peptide;Acc:NP_001096143]
Human Orthologue:
NPR3
Human Description:
natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) [Source:HGN
Mouse Orthologue:
Npr3
Mouse Description:
natriuretic peptide receptor 3 Gene [Source:MGI Symbol;Acc:MGI:97373]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6997 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6997
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074796 Nonsense 38 472 1 8
ENSDART00000143446 Nonsense 68 502 1 8
Genomic Location (Zv9):
Chromosome 5 (position 42925601)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40706866
GRCz11 5 41307019
KASP Assay ID:
554-4889.1 (used for ordering genotyping assays)
KASP Sequence:
TTGAGTACGCGAAAAAAGCCCTCAGAGAAGCAGACGCGTATGCGGGACTG[A/T]GATTCAATGTGCGCTTTGAGAACTCCGCGTGCGGGATGGACGCTCTCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8198
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074796 Nonsense 244 472 3 8
ENSDART00000143446 Nonsense 274 502 3 8
Genomic Location (Zv9):
Chromosome 5 (position 42904997)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40686262
GRCz11 5 41286415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTATTTCTTTTTCTTTTTTACAGGGGATGGATCCTGGAGGAGAAGAGAC[A/T]AATATGACGATGAAGCCAGGGCTGCCTACAGCTTTCTCAACACTGTAACG
Associated Phenotype:
Not determined