Busch Lab

ZMP

si:ch73-270f14.1

Ensembl ID:
ENSDARG00000035178
ZFIN IDs:
ZDB-GENE-040808-7, ZDB-GENE-081104-273
Description:
guanine nucleotide binding protein (G protein), alpha 14 [Source:RefSeq peptide;Acc:NP_001003753]
Human Orthologue:
GNA14
Human Description:
guanine nucleotide binding protein (G protein), alpha 14 [Source:HGNC Symbol;Acc:4382]
Mouse Orthologue:
Gna14
Mouse Description:
guanine nucleotide binding protein, alpha 14 Gene [Source:MGI Symbol;Acc:MGI:95769]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5322 Nonsense F2 line generated Not yet available
sa20539 Nonsense Available for shipment Available now
sa7007 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5322
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 None None 354 1 7
ENSDART00000134039 Nonsense 11 56 1 1
Genomic Location (Zv9):
Chromosome 5 (position 56938168)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54890694
GRCz11 5 55560911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACTGCCTAGTGAGCTGATGTATGCATTGACTGTGAAGTACTGGAGGTG[G/A]TTAAGACGGTTCAGGATGGAGGAGTGCTGTTTATCAGGYGAAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20539
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Nonsense 176 354 4 7
ENSDART00000134039 None None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56926795)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54879321
GRCz11 5 55549538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACAGAATAGCTGCAGGGTTTTACATGCCGACCTTGCAGGATATTCTA[C/T]GAGTCCGAGTTCCAACCACAGGCATCATTGAATACGTCTTTGACCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7007
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Essential Splice Site 241 354 6 7
ENSDART00000134039 None None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56926441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54878967
GRCz11 5 55549184
KASP Assay ID:
554-5159.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAACTTTGGATTTGAWTCTTTTTGTTTATAYGATGTTATTCCTCCAC[A/G]GAATCGAATGGAAGAAAGCAAGGCACTTTTTAAGACAATCATCTCCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Nonsense 320 354 7 7
ENSDART00000134039 None None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56921772)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54874298
GRCz11 5 55544515
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTGAAAATGTATGAGGAACAGAACCCCGACAAACAGAAGCGGATCTA[T/A]GCACATTTTACCTGTGCGACTGACACTGAAAATATCCGTTTTGTTTTTGA
Associated Phenotype:
Not determined