Busch Lab

ZMP

ap2b1

Ensembl ID:
ENSDARG00000035152
ZFIN ID:
ZDB-GENE-030131-6564
Description:
AP-2 complex subunit beta [Source:RefSeq peptide;Acc:NP_956213]
Human Orthologue:
AP2B1
Human Description:
adaptor-related protein complex 2, beta 1 subunit [Source:HGNC Symbol;Acc:563]
Mouse Orthologue:
Ap2b1
Mouse Description:
adaptor-related protein complex 2, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1919020]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14392 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2269
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050916 Essential Splice Site None 951 1 22
ENSDART00000134387 Essential Splice Site None 598 1 13
Genomic Location (Zv9):
Chromosome 5 (position 64720453)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60973113
GRCz11 5 61657834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATAACCACACATCTGTACATCCCGCGTCGATTCTTACATCGCTTGTCCG[T/A]ATGTATTTACATCAKCTGTTTGCTTCCCAATTTAGGACACGWCAGGCGGC
Long Flanking Sequence:
TTATTAATGGGTAAATATAATAAATATTCTTGTAAATGGAAAAAAATTGGCCCTCTTTTAATAGTTTTCTTTTTTAGGAGAAGGAAAGTGGTTCAAAACAGAATAACTGAAGCCTTTTGTAGTGCAATCTCAAAATATACATTATTATTTGCTCCCCGATGCTTGTTTTGTTGGATTTGTTGTATTTTATTTAAATGTGTGTGTATATTATGATGTTGACTTTTCCCTGTTTTGTGGTTTAAAATTTGCAGTAATAAAACAGTCGAAATAAAAGTAGTGAACAATAATAATCTGCATCTGGTGTATCATTTGCGTGGCTCCGACGTCGCACCTTCTCCTCGTTTACTGGTTCCGCTCGTCATTTTGTTTTTCCGGGTGCGCTCCATCTTCCAGCGCCGACCGAGCTGTGCCAACAACCGCATCTTCCATCTCCTCGTTGGGAAGTGCTGCAATAACCACACATCTGTACATCCCGCGTCGATTCTTACATCGCTTGTCCG[T/A]ATGTATTTACATCATCTGTTTGCTTCCCAATTTAGGACACGACAGGCGGCTATTTTTAGCCGATAAAGGTCCTGATTTCCAAGATTTTCACTAGCCTAGCATAGCTGGATCATTTATTTCGGTCACGCCCCATTTTTAAACGCAAAAAGGATTAAAATTGGTGACACACAGCTTTAAATAATGAGTTGAAGATGTGTGTTTGGTGTATGTAGTCGGTGGCTTGTGTTGTCGTGTTGTTTGTTCGTGTAGTATATGGTCCACACATAACTGTCCCCTGATGATTTCCTGTGTAAAACTGAGATTTGAAGACCTTTTCCTAATTTTATGAACGCATAAATATTTTAATTTAGCATTTAATTTAGTGAGGATATTGTACAGATTTTCTGAATTGCTAAAATGTTGTTTTGGGAATGTACTTCATATGAACTTGAAGTGATTTCCTCCTTTGCAGATTTGAGAAGCTGTCAGAATGACTGACTCAAAGTATTTCACCACCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14392
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050916 Nonsense 400 951 10 22
ENSDART00000134387 Nonsense 400 598 10 13
Genomic Location (Zv9):
Chromosome 5 (position 64737657)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60990317
GRCz11 5 61675038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCTAGCAATCCGCTGAGCGCTGTGTTAGCACCCTGCTGGACCTTATC[C/T]AGACCAAAGTCAACTACGTCGTGCAGGAAGCCATTGTGGTCATCAGGGAC
Long Flanking Sequence:
ACTATTCCACATAACTGTCTGATAAATCTTTTGTTTGCACATAAAATGCACATTCCCAAACATAAATCAGCGTTTTAAAAAATTGTATGTTCTCAAAGTGAGTTTACTAAATGAGTTTAACTTCTGAAAGTCAAGTGTTATTTTGGGGTTTCCGCCTGGATTTTGCCCACCCAAATTCAAAAGATTCCCAAATCCACATGCAGAGGTGTAAATGCAAAAGTTTGGTATCGTTTAAAAAGAAAACTCTTTGAATTGCACAAAACACTGCTGAAAGTGATTAAAATAATTGTATAACATAACATTTGTCATAATAAACAATTTGTTTTTGTAAACTCAAATTTGAATGTGTACCTTTTTTAGGTTCTGTGTGGTCTAGGTTGCTGTAATTAATTTGGTTGATTCCCGCACATGTCAGTAATTTGTTGATTATAAATCTTCACTTGTATCTGTGTTTCTAGCAATCCGCTGAGCGCTGTGTTAGCACCCTGCTGGACCTTATC[C/T]AGACCAAAGTCAACTACGTCGTGCAGGAAGCCATTGTGGTCATCAGGGACATCTTCCGCAAATATCCCAACAAGTCAGTCCATAGCTCCCATATATATGCATTCAATTTCTGCATGAAACAGTTTCTCTTGTCTACTCCACCACTCATATCAGTGGGTGCATGATCACAGTGAAAAAACTGTACAAAAGCACGCACATCTCTCTTAATTGGGTGCTCAGCCAAAACCGCAAAAAGTGCAAATTGAATGTAAATCAAAGGCGGCAACACCGAGGCTCCAAAAATACTAATTTATTAAATTAAAAAGGCTGACACAGAGCGTGTAACGTTTCGAGCCGCCGGCTCTTCATCAGACAATGTTTATCACAATCAGGTGCTTCTTTTTATACACTTCCGGATCACATGATCTCCTCTCACATAAATGTCAACATATACATACATGCATATGTATTCATACACAGTCGTTCATATATACATATACATACACATGAATACGAATTGG
Associated Phenotype:
Not determined