Busch Lab

ZMP

si:dkey-197m14.2

Ensembl ID:
ENSDARG00000035137
ZFIN ID:
ZDB-GENE-060531-86
Human Orthologue:
EHD2
Human Description:
EH-domain containing 2 [Source:HGNC Symbol;Acc:3243]
Mouse Orthologue:
Ehd2
Mouse Description:
EH-domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2154274]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20565 Nonsense Available for shipment Available now
sa45230 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8209
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 176 546 4 6
Genomic Location (Zv9):
Chromosome 5 (position 65045686)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61321176
GRCz11 5 61983913
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACTTCTCTTTTTTCCATCAGGTTATGACTTTCCTTCAGTTATYCGCTG[G/A]TTTGCRGAGCACGTWGACCGGATCATCCTCCTGTGTGATGCACAYAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20565
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 188 546 4 6
Genomic Location (Zv9):
Chromosome 5 (position 65045722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61321212
GRCz11 5 61983949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGTTATCCGCTGGTTTGCGGAGCACGTAGACCGGATCATCCTCCTGTG[T/A]GATGCACACAAGCTGGAGATTTCTGATGAGTTTTCCCGCACTATACTGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5330
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 375 546 6 6
Genomic Location (Zv9):
Chromosome 5 (position 65053678)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61329168
GRCz11 5 61991905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGGAGCGACTCATGAGCCACGACTTCAAGTTTAAAGGCCTCAAGCCC[A/T]AGCTCTTRGCTGGRTTGGATGAGCTCCTAAACACYGACATTGCYAARCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45230
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 507 546 6 6
Genomic Location (Zv9):
Chromosome 5 (position 65054075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61329565
GRCz11 5 61992302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCAGATGTGGATTGTGATGGTAAGTTGGACGATGAGGAGTTTGCTT[T/A]GGCCGGTCATCTCATTGAGGTAAAGTTGGAAGGTTTTGGGCTTCCTCATG
Associated Phenotype:
Not determined