Busch Lab

ZMP

zgc:113114

Ensembl ID:
ENSDARG00000035074
ZFIN ID:
ZDB-GENE-050306-11
Description:
Regulator of telomere elongation helicase 1 [Source:UniProtKB/Swiss-Prot;Acc:P0C928]
Mouse Orthologue:
Rtel1
Mouse Description:
regulator of telomere elongation helicase 1 Gene [Source:MGI Symbol;Acc:MGI:2139369]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10862 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10862
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066122 None None 443 None 11
ENSDART00000104127 None None 442 None 12
ENSDART00000123445 Nonsense 119 1177 3 33
Genomic Location (Zv9):
Chromosome 11 (position 12874016)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12758425
GRCz11 11 12816084
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATACTGACATTCCCAAGATCATATATGCCTCCAGGACTCATTCGCAGT[T/A]AACACAAGTTGTAAATGAGCTGAAGAATACATCATACAGGTCAGTCAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27745
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066122 None None 443 None 11
ENSDART00000104127 None None 442 None 12
ENSDART00000123445 Essential Splice Site 599 1177 20 33
Genomic Location (Zv9):
Chromosome 11 (position 12890295)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12774704
GRCz11 11 12832363
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAAACCCATGTTTGTAGAGCCGAGGGGTAAAGGCACTTTTACAGAGG[T/C]AACTTCATCTGCTGTCTGTTATTTAAACATCATGCATTTATACTCGCACA
Associated Phenotype:
Not determined