Busch Lab

ZMP

retsatl

Ensembl ID:
ENSDARG00000034989
ZFIN ID:
ZDB-GENE-051113-252
Description:
retinol saturase-like [Source:RefSeq peptide;Acc:NP_001035093]
Human Orthologue:
RETSAT
Human Description:
retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
Mouse Orthologue:
Retsat
Mouse Description:
retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa11225 Nonsense Available for shipment Available now
sa10711 Nonsense Available for shipment Available now
sa21592 Nonsense Available for shipment Available now
sa21593 Nonsense Available for shipment Available now
sa21594 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11225
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 3 607 1 11
ENSDART00000141434 Nonsense 3 604 1 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46061767)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45193432
GRCz11 9 44994384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAAATTCAAAGTTACAGNYYTTTTCTGCCAKTGATTGAAGATGTGGTG[G/A]MTTTTGYTGTTCTTAGAATGGTTTGTAGACTGGGCTCRYGGCACATTCTG
Long Flanking Sequence:
AGTACATAAGGGTTAAAGTAAATCTAACACTTTGATTTATCACATATGCAACTTAAATGTTTACATGCATTATAGTTTATTGTTGACCATCTGCAACTCCTTCCTTCAATACACTAAATCAATACAAACAGCTAATTAACCCATATTATAAGTATATATGTATATAAACACAAAAAAATGCCTACATTCTTGTACTGGCTTCCATTTTGTGCATCACAGCTGTTATTCATTATAAGCAACTAATGCAAAGCAATCGGTCTGCACACCTGATTTAATTAAGTAACACAAATAGCAGACAAACAAGTTGATTCTCTCCACCCACGGTTTAGACTAATAAATAAGGCCTTGACGCGTTCACCAAATAAAAAGCTGTTGGTTGCAGTCTCTGGAAAGAGCTGCTACTTAAGCTTTTAACACTACTTTTAAAGAGTGAATCTTCTAGCAGTCACTCCTCAAATTCAAAGTTACAGTCTTTTCTGCCAGTGATTGAAGATGTGGTG[G/A]ATTTTGCTGTTCTTAGAATGGTTTGTAGACTGGGCTCGTGGCACATTCTGGTATCTGTTTGGCAGGAGAAGTGGCCTGTGCAAGGGTACCATCAGTCCTCAAGGCCCGCTAGTAGTCGACCAGGAGAAAAAAGACAAAGTGCTTCAGAAAGGTATGTGAGCTCTCTAGATTAGTGATATAATAGAGGCACCTAGTGTTCCACTATGTAAATGCAGCAAATATAAGGAAAAAAAACATAGGTACTTCAGTATAAAGCATAATATAAGTACATGTGCCTTGCTAAATATCATGGTGCCTGTAAATGGTTTTTAAGTACACTTTTGGAGTCTGTTTCATTGCTGAACAGATCAATGAAACACTTGACTAATGGTATAACTCTAAAATTTTCTCTGGTAATTGTTTAAACCAGGGGTGCCCAGACTCTCTCCTGGAGGGCCGGTGTCCTGCAAAGTGTAGTTCCAATCCAATAAGACCCACCTGGGCTGGTTAATCAAGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 231 607 4 11
ENSDART00000141434 Nonsense 231 604 4 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46063328)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45194993
GRCz11 9 44995945
KASP Assay ID:
2260-2473.1 (used for ordering genotyping assays)
KASP Sequence:
TGCTCGCTTYATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTT[T/A]AAAATAYTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTYACCAGCA
Long Flanking Sequence:
TACAGCTGCATGGATGGGAATGCTGAATGTCTTGCCGCACATGACTAAGATTGCTTTGTTTTTATTTTTTGAAGGCTTCTATTATGTTGGTCAACTTCATGAGAACAGCTTCCTGAAGATTGCTTTGGATTTGATTACTGATGGCCAAGTGCACTTTGCTGAGCAAGGTTCACATGTGGAAACTGTTGTTATTGGTAAAGGGCCTGAGTGTAAAGAATACACTATCTATAATGGTAAAAAGCAGATGGAGGCTCATCTGAAGAAACAGTTCCCCAATGATGCTAAAGCAGTAGAGGAATTCTTTAAAATAATGAAGGTATTTGGTTTTATTTATTCCTTTTAAATCTTAACGTTCCCTTTGCTTTATCATCTAAACTATTGTTTACCCTAATAGATTTGTTCTGAGAAGGTCCGTCTGCTTTGTATGCTGAAGATGGTCCCACTCTGGTTTGCTCGCTTCATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTT[T/A]AAAATATTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTTACCAGCAACCAGGATCTCCTCACAGTGTTCTCAAAAACATTTTGTGGTAAAATAACCATTCCAAACTCTGGATTCATCCAGTGTCGAGGCTTCTGACTAAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCCCCCTAGGTGTCCCACCCAAAAACTCCAGCTGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTATCCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGAGAAACATGGTGGAAAAGTCCTGGTCAATGCTCCAGTTTCTAGAGTTCTAGTTAATGAGCAACAAAATGCATACGGTGAGGTTTGTTCAAGTCAGACATACCCAATCCTGTTCCTGGAGCTCTACCTTCCTGTAGAGTTTACCTCCAACCCTGATCAGTAACTGGAGGAAGTAGGATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21592
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 288 607 5 11
ENSDART00000141434 Nonsense 285 604 5 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46063598)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45195263
GRCz11 9 44996215
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTA[T/A]CCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGA
Long Flanking Sequence:
CCCCAATGATGCTAAAGCAGTAGAGGAATTCTTTAAAATAATGAAGGTATTTGGTTTTATTTATTCCTTTTAAATCTTAACGTTCCCTTTGCTTTATCATCTAAACTATTGTTTACCCTAATAGATTTGTTCTGAGAAGGTCCGTCTGCTTTGTATGCTGAAGATGGTCCCACTCTGGTTTGCTCGCTTCATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTTTAAAATATTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTTACCAGCAACCAGGATCTCCTCACAGTGTTCTCAAAAACATTTTGTGGTAAAATAACCATTCCAAACTCTGGATTCATCCAGTGTCGAGGCTTCTGACTAAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCCCCCTAGGTGTCCCACCCAAAAACTCCAGCTGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTA[T/A]CCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGAGAAACATGGTGGAAAAGTCCTGGTCAATGCTCCAGTTTCTAGAGTTCTAGTTAATGAGCAACAAAATGCATACGGTGAGGTTTGTTCAAGTCAGACATACCCAATCCTGTTCCTGGAGCTCTACCTTCCTGTAGAGTTTACCTCCAACCCTGATCAGTAACTGGAGGAAGTAGGATCTGAAGGAGCACTTTGTAATCTTAAGGCCAACGCTTTAAGGTTCCAGCTAACTCTGCAGCCAGGTAGATCTTCAGGAACTGGATTTGGCACCTCCTGTGAACAGTTGCTTTTGCAGTGTCTTGAGGTATAATGTAATGAGCACATGTCTGCTTCAGGTGTGGCTGTGAAGACTGGAGATGAAGATATTGAAATCAAAGCTTCAGTGGTTGTTTCAAATGCTGGTGTGTTCACTACTTTCCAGAAGCTCCTGACTCCAGAGATCCAGGCAGATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5568
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 326 607 5 11
ENSDART00000141434 Nonsense 323 604 5 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46063710)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45195375
GRCz11 9 44996327
KASP Assay ID:
554-3564.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAGTCCTGGTCAATGCTCCAGTTTCTAGAGTTCTAGTTRATGAGCAA[C/T]AAAATGCATAYGGTGAGNNTTGTTCAAGTCAGACATACCCARTCCTGTTC
Long Flanking Sequence:
TTACCCTAATAGATTTGTTCTGAGAAGGTCCGTCTGCTTTGTATGCTGAAGATGGTCCCACTCTGGTTTGCTCGCTTCATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTTTAAAATATTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTTACCAGCAACCAGGATCTCCTCACAGTGTTCTCAAAAACATTTTGTGGTAAAATAACCATTCCAAACTCTGGATTCATCCAGTGTCGAGGCTTCTGACTAAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCCCCCTAGGTGTCCCACCCAAAAACTCCAGCTGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTATCCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGAGAAACATGGTGGAAAAGTCCTGGTCAATGCTCCAGTTTCTAGAGTTCTAGTTAATGAGCAA[C/T]AAAATGCATACGGTGAGGTTTGTTCAAGTCAGACATACCCAATCCTGTTCCTGGAGCTCTACCTTCCTGTAGAGTTTACCTCCAACCCTGATCAGTAACTGGAGGAAGTAGGATCTGAAGGAGCACTTTGTAATCTTAAGGCCAACGCTTTAAGGTTCCAGCTAACTCTGCAGCCAGGTAGATCTTCAGGAACTGGATTTGGCACCTCCTGTGAACAGTTGCTTTTGCAGTGTCTTGAGGTATAATGTAATGAGCACATGTCTGCTTCAGGTGTGGCTGTGAAGACTGGAGATGAAGATATTGAAATCAAAGCTTCAGTGGTTGTTTCAAATGCTGGTGTGTTCACTACTTTCCAGAAGCTCCTGACTCCAGAGATCCAGGCAGATCCCCGTATGTGATCTGTTTACCAGTTCTCCTGCAGTAACTTAACATGGTCCTAACCAGTTTTCCATGTGGGCTGTTTATTTGATCTATCTAATCTTTCCCCCTACCTTGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21593
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 386 607 7 11
ENSDART00000141434 Nonsense 383 604 7 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46064276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45195941
GRCz11 9 44996893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTCCAGGAATATCTTAAAGCTCTGAAACCAGGCAAAGGCTTTTTT[C/T]AAGTATTTGCTGGCTTCAATGCCACAATGGAAGAACTAGGCATCTCTTCA
Long Flanking Sequence:
CCTGTAGAGTTTACCTCCAACCCTGATCAGTAACTGGAGGAAGTAGGATCTGAAGGAGCACTTTGTAATCTTAAGGCCAACGCTTTAAGGTTCCAGCTAACTCTGCAGCCAGGTAGATCTTCAGGAACTGGATTTGGCACCTCCTGTGAACAGTTGCTTTTGCAGTGTCTTGAGGTATAATGTAATGAGCACATGTCTGCTTCAGGTGTGGCTGTGAAGACTGGAGATGAAGATATTGAAATCAAAGCTTCAGTGGTTGTTTCAAATGCTGGTGTGTTCACTACTTTCCAGAAGCTCCTGACTCCAGAGATCCAGGCAGATCCCCGTATGTGATCTGTTTACCAGTTCTCCTGCAGTAACTTAACATGGTCCTAACCAGTTTTCCATGTGGGCTGTTTATTTGATCTATCTAATCTTTCCCCCTACCTTGGTGGCGGTTTTCTGCCTCTCCAGAGGTCCAGGAATATCTTAAAGCTCTGAAACCAGGCAAAGGCTTTTTT[C/T]AAGTATTTGCTGGCTTCAATGCCACAATGGAAGAACTAGGCATCTCTTCAACTGACATGCGGCTCTATAAGGGCAACAACGTTGATGAGATGTATGTGTACAAGTACATTGATCACTCAATGCTATCTATTCTTCCTGCTAGTTCTTACTTTATTTTTCCGTTCCCTGTAGGATGGAGGAGTACTTTGCTTCAGACAAGCAAGATGCACCTGATAATGTCCCCATGATGTATCTTTCCTTCCCCTCTGCTAAGGATCCCACCTCAAGCACTCGTTTCCCAGGTTCACTTTCTTATTGGTATATTAAGTGTCCAGAACAATCAAGCAAGCCAGGTTAATCTAGTTATGGGTGATTCTCTATTGTAGGGCAATCACGTATGGTGATCCATACTTTGGTCAATCCAAAGTGGTTTGAACAGTGGGAAAACGTTAATGAGGCTGAAAGAGGTGAAGAATATGAGAACTACAAGATGAGATTTGCCAATCATCTGTTTGACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21594
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Essential Splice Site 416 607 None 11
ENSDART00000141434 Essential Splice Site 413 604 None 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 46064446)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45196111
GRCz11 9 44997063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTATCTATTCTTCCTGCTAGTTCTTACTTTATTTTTCCGTTCCCTGT[A/G]GGATGGAGGAGTACTTTGCTTCAGACAAGCAAGATGCACCTGATAATGTC
Long Flanking Sequence:
TGAGGTATAATGTAATGAGCACATGTCTGCTTCAGGTGTGGCTGTGAAGACTGGAGATGAAGATATTGAAATCAAAGCTTCAGTGGTTGTTTCAAATGCTGGTGTGTTCACTACTTTCCAGAAGCTCCTGACTCCAGAGATCCAGGCAGATCCCCGTATGTGATCTGTTTACCAGTTCTCCTGCAGTAACTTAACATGGTCCTAACCAGTTTTCCATGTGGGCTGTTTATTTGATCTATCTAATCTTTCCCCCTACCTTGGTGGCGGTTTTCTGCCTCTCCAGAGGTCCAGGAATATCTTAAAGCTCTGAAACCAGGCAAAGGCTTTTTTCAAGTATTTGCTGGCTTCAATGCCACAATGGAAGAACTAGGCATCTCTTCAACTGACATGCGGCTCTATAAGGGCAACAACGTTGATGAGATGTATGTGTACAAGTACATTGATCACTCAATGCTATCTATTCTTCCTGCTAGTTCTTACTTTATTTTTCCGTTCCCTGT[A/G]GGATGGAGGAGTACTTTGCTTCAGACAAGCAAGATGCACCTGATAATGTCCCCATGATGTATCTTTCCTTCCCCTCTGCTAAGGATCCCACCTCAAGCACTCGTTTCCCAGGTTCACTTTCTTATTGGTATATTAAGTGTCCAGAACAATCAAGCAAGCCAGGTTAATCTAGTTATGGGTGATTCTCTATTGTAGGGCAATCACGTATGGTGATCCATACTTTGGTCAATCCAAAGTGGTTTGAACAGTGGGAAAACGTTAATGAGGCTGAAAGAGGTGAAGAATATGAGAACTACAAGATGAGATTTGCCAATCATCTGTTTGACTGGGCTTGTGTCCGTTTTCCCCAGTTGAAAGAAAAGGTACGTTTTTGGAGTAATGCTCATTTCCCCCGCCCCCCTTTTTTGTGTAATGACCCAAACATTTAGATACAATTTAAGGCTATATACCCTTTGGGTACAAATGTTGTCCTACAGTTTGACCTACCAGCTATAAAACCT
Associated Phenotype:
Not determined