Busch Lab

ZMP

si:dkey-224e22.2

Ensembl ID:
ENSDARG00000034941
ZFIN ID:
ZDB-GENE-061207-59
Description:
Beta-galactosidase [Source:UniProtKB/TrEMBL;Acc:A2BIK1]
Human Orthologues:
GLB1L2, GLB1L3
Human Descriptions:
galactosidase, beta 1-like 2 [Source:HGNC Symbol;Acc:25129]
galactosidase, beta 1-like 3 [Source:HGNC Symbol;Acc:25147]
Mouse Orthologues:
Glb1l2, Glb1l3, Gm1110
Mouse Descriptions:
galactosidase, beta 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:1918143]
galactosidase, beta 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:2388283]
predicted gene 1110 Gene [Source:MGI Symbol;Acc:MGI:2685956]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6534 Nonsense Mutation detected in F1 DNA Not yet available
sa36723 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6534
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098523 Nonsense 68 633 3 20
ENSDART00000132775 Nonsense 30 222 1 7
ENSDART00000139690 Nonsense 30 603 2 19
Genomic Location (Zv9):
Chromosome 18 (position 43166919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44756810
GRCz11 18 44750264
KASP Assay ID:
554-5216.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACTTTAGCAGGAGCTCCGTTTCGGATCTTGGGAGGCTYCATCCACTA[T/A]TTTCGGGTGCCCAGGGCCCACTGGAGAGATCGGCTGCTGAAACTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4022
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098523 Nonsense 275 633 10 20
ENSDART00000132775 Nonsense 205 222 7 7
ENSDART00000139690 Nonsense 237 603 9 19
Genomic Location (Zv9):
Chromosome 18 (position 43172311)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44762202
GRCz11 18 44755656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
SCATTTTCTGTCCTGCAGCCACAGAAGCCGCTGATGGTGATGGAGTATTG[G/A]TCTGGCTGGTTTGAKGTCTGGGGAGAACTGCATCATGTTTTCTCTGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098523 Essential Splice Site 338 633 11 20
ENSDART00000132775 None None 222 None 7
ENSDART00000139690 Essential Splice Site 300 603 10 19
Genomic Location (Zv9):
Chromosome 18 (position 43173974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44763865
GRCz11 18 44757319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCGGAGCAGTTGATTTGGGCACCTACAAACCACAGACAAGCAGCTATG[G/C]TTAGTAGTTTTAATAATCATGCCCACATGAAAAATAAGAATAGTAGTTTA
Associated Phenotype:
Not determined