Busch Lab

ZMP

wnt5b

Ensembl ID:
ENSDARG00000034894
ZFIN ID:
ZDB-GENE-980526-87
Description:
Protein Wnt-5b [Source:UniProtKB/Swiss-Prot;Acc:Q92050]
Human Orthologues:
WNT5A, WNT5B
Human Descriptions:
wingless-type MMTV integration site family, member 5A [Source:HGNC Symbol;Acc:12784]
wingless-type MMTV integration site family, member 5B [Source:HGNC Symbol;Acc:16265]
Mouse Orthologues:
Wnt5a, Wnt5b
Mouse Descriptions:
wingless-related MMTV integration site 5A Gene [Source:MGI Symbol;Acc:MGI:98958]
wingless-related MMTV integration site 5B Gene [Source:MGI Symbol;Acc:MGI:98959]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33385 Nonsense Mutation detected in F1 DNA Not yet available
sa45164 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8155
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041852 Nonsense 69 363 4 6
ENSDART00000074651 Nonsense 69 363 5 7
ENSDART00000122986 Nonsense 86 380 2 4
Genomic Location (Zv9):
Chromosome 4 (position 7518836)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8639700
GRCz11 4 8640616
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCAGCTGACGGGCCTATCTCAGGRTCAGAGGAAGCTCTGCCAGCTCTA[T/A]CAGGACCACATGGTTTATATTGGAGAGGGGGCGAAGACGGGCATCAAAGA
Long Flanking Sequence:
TGGCTCTAACTGAGAAGACTGATCGAGCAAAAGTTGTATGTCTAAACTGCACAGCACAGTCTCCCCTGGTAATAGATCGTGTTGATTGACCATTATTGTTCTTGTGTGCCACAAACTCACATAATGGAGGTGGAGCATATCCATTTAAAATTTTAAAAATCATACAAGCATCAGCCAAATATTTCATATTATCAAAGCTCAATAAATAATGTTTTTTTGTTATTTTACAATGATGATACCTAATAGATTTCCCATTATATACATCATTAGGGTAGCCTGATGAAGTTTTACATTATAAATAACAATTTAGAGTCACAAATAGTCATGCATATTTAATCCTGTGCTATATTTAGCTGATGGTAAAAGCTTTGGTCTTGCTTTCTCAGGTCATTAGCCATGAACCCCATCCAGAGACCGGAGATGTACATCATTGGAGCACAGCCTCTGTGCAGCCAGCTGACGGGCCTATCTCAGGGTCAGAGGAAGCTCTGCCAGCTCTA[T/A]CAGGACCACATGGTTTATATTGGAGAGGGGGCGAAGACGGGCATCAAAGAGTGCCAGTATCAGTTCAGACAGAGGCGATGGAACTGCAGTACAGTGGACAACACGTCAGTGTTCGGCCGCGTCATGCATATAGGTGAGTTGACCTGGTGATCTCTAAAAGTACATGGCTAAAAGACTAAAAGTGGAGTATATGCCAAATTATCTTGTTAGGTGTATTTAGAATAAAAATCATTTGATGCCATCTTTGGATAACACTGCAGCACCAAATACTAATTACTTGACATTTTCATTATTTATTCTTAAATCTGTCCTTCAAATGACCCATTTGCCAGCCTAACATTTTAATTATTTCAAAATATAATAATTTAGTTTGATCACTTGTTATTTTTATTAGTCAAGAGAAGTATGTTGTTTATTATTTACATAAATGTGTCTGTCACACTGAATGACAACAGAACTTTTTTCACCAATATTTTGACATTGTGTTTTTTACAAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33385
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041852 Nonsense 78 363 4 6
ENSDART00000074651 Nonsense 78 363 5 7
ENSDART00000122986 Nonsense 95 380 2 4
Genomic Location (Zv9):
Chromosome 4 (position 7518811)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8639725
GRCz11 4 8640641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGGAAGCTCTGCCAGCTCTATCAGGACCACATGGTTTATATTGGA[G/T]AGGGGGCGAAGACGGGCATCAAAGAGTGCCAGTATCAGTTCAGACAGAGG
Long Flanking Sequence:
AGCAAAAGTTGTATGTCTAAACTGCACAGCACAGTCTCCCCTGGTAATAGATCGTGTTGATTGACCATTATTGTTCTTGTGTGCCACAAACTCACATAATGGAGGTGGAGCATATCCATTTAAAATTTTAAAAATCATACAAGCATCAGCCAAATATTTCATATTATCAAAGCTCAATAAATAATGTTTTTTTGTTATTTTACAATGATGATACCTAATAGATTTCCCATTATATACATCATTAGGGTAGCCTGATGAAGTTTTACATTATAAATAACAATTTAGAGTCACAAATAGTCATGCATATTTAATCCTGTGCTATATTTAGCTGATGGTAAAAGCTTTGGTCTTGCTTTCTCAGGTCATTAGCCATGAACCCCATCCAGAGACCGGAGATGTACATCATTGGAGCACAGCCTCTGTGCAGCCAGCTGACGGGCCTATCTCAGGGTCAGAGGAAGCTCTGCCAGCTCTATCAGGACCACATGGTTTATATTGGA[G/T]AGGGGGCGAAGACGGGCATCAAAGAGTGCCAGTATCAGTTCAGACAGAGGCGATGGAACTGCAGTACAGTGGACAACACGTCAGTGTTCGGCCGCGTCATGCATATAGGTGAGTTGACCTGGTGATCTCTAAAAGTACATGGCTAAAAGACTAAAAGTGGAGTATATGCCAAATTATCTTGTTAGGTGTATTTAGAATAAAAATCATTTGATGCCATCTTTGGATAACACTGCAGCACCAAATACTAATTACTTGACATTTTCATTATTTATTCTTAAATCTGTCCTTCAAATGACCCATTTGCCAGCCTAACATTTTAATTATTTCAAAATATAATAATTTAGTTTGATCACTTGTTATTTTTATTAGTCAAGAGAAGTATGTTGTTTATTATTTACATAAATGTGTCTGTCACACTGAATGACAACAGAACTTTTTTCACCAATATTTTGACATTGTGTTTTTTACAAAAGTTGTTTGCAACATTTAATCAGGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45164
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041852 Essential Splice Site 211 363 5 6
ENSDART00000074651 Essential Splice Site 211 363 6 7
ENSDART00000122986 Essential Splice Site 228 380 3 4
Genomic Location (Zv9):
Chromosome 4 (position 7513473)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 8645165
GRCz11 4 8646081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACGCACGCACGCTTATGAATCTGCAGAACAATGAAGCCGGAAGAATG[G/A]TGAGGAAATAAACACACACATCAGTGATCTGCTTTCTTATTTTTGGCTGT
Long Flanking Sequence:
TTCACATTTGTCCGTGCTTTTATTTTCTTTATTTAATTTAAATGCATGATTTACTCCTCTACAGAATCATCCAAATCCAGAGCTGTTCAAGCTCTCTGTTAAAATTGTCCATAGAAAAACAAAATATTGCAATGTCATATTTTTTCTAATATCACACAGCCCTAGTGGAATGTTTCCTAATTATGTGTTCATGTGTGTTTTGTGCAGGCAGCCGAGAAACAGCTTTTACATACGCCGTCAGCGCAGCGGGTGTTGTGAATGCTGTGAGTCGAGCGTGCCGTGAGGGTGAGCTTTCCACCTGCGGCTGCAGTCGAGCGGCTCGTCCCAGAGACCTGCCCAGAGACTGGCTGTGGGGCGGCTGCGGGGACAACGTCAACTATGGCTACCGCTTCGCCCGGGAGTTTGTGGACGCTCGTGAACGTGAGAAGAACTACCCACGCGGATCGGTGGAACACGCACGCACGCTTATGAATCTGCAGAACAATGAAGCCGGAAGAATG[G/A]TGAGGAAATAAACACACACATCAGTGATCTGCTTTCTTATTTTTGGCTGTGGATGCCATACTGGGCGTTAATAAGACCAGTTTGGGTTCATACAAGTGTTTATACTGTAAGAAAAATTCATGAAAAACAGATATTATACTGGCAGGTACCGTGCATTCGGAAAGTATTGATAGCACTTCACTTTTTCCAAATTATTTATGTTACAGCCTTATTCCAAAATGGATTAAATTAAGTTATTTCCACAAAATTCTACACTCAATCCCCCATAATGACAATGAAAAAAAAGAGTTTTTGAAATTGGTGCAAATTTTATTGAAAAATAAAAAAACCTGAAAAATGACATGTACATCAGTATTCACAACCTCACTACTTTGCTCTGTAAGTTTGCTCTTTGTCTCTGTGCAATGCTGCATTCATCTTTCCCTCTATCCTGACTAGTCCTCCAGTTCCTGCTGCTGAAATACATCTTTACAGCATGAGACTGCCACCACCATGCTTCA
Associated Phenotype:
Not determined