Busch Lab

ZMP

c13orf22l

Ensembl ID:
ENSDARG00000034825
ZFIN ID:
ZDB-GENE-040930-7
Description:
hypothetical protein LOC445403 [Source:RefSeq peptide;Acc:NP_001003880]
Human Orthologue:
USPL1
Human Description:
ubiquitin specific peptidase like 1 [Source:HGNC Symbol;Acc:20294]
Mouse Orthologue:
Uspl1
Mouse Description:
ubiquitin specific peptidase like 1 Gene [Source:MGI Symbol;Acc:MGI:2442342]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34950 Nonsense Mutation detected in F1 DNA Not yet available
sa34951 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043802 Nonsense 287 1014 4 9

The following transcripts of ENSDARG00000034825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37687512)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36499673
GRCz11 10 36443431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATTGCTCACACTGAGGAGAAACCTGTGTCTCTTGTTCACACTGAGGAT[C/T]AACATTTGTCTATTGATCAAACAGAGGAACAACCCATCTCAATTGATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34951
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043802 Nonsense 360 1014 4 9

The following transcripts of ENSDARG00000034825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37687731)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36499892
GRCz11 10 36443650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTTCTTCAGAGCTGGTCCCGGTTCATTCTGAACTCTTCTGGAAAAAC[G/T]AGGAGAACATGTGCTGGTTGGATGCGATGTTGGTGATGCTGGTGCACTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27651
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043802 Nonsense 376 1014 4 9

The following transcripts of ENSDARG00000034825 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37687781)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36499942
GRCz11 10 36443700
KASP Assay ID:
2260-3520.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAGAACATGTGCTGGTTGGATGCGATGTTGGTGATGCTGGTGCACTG[C/A]AGGACCATCAGAGGGACTCCATGTCGGGGCATAAAGCTGAGCGATAAGTT
Associated Phenotype:
Not determined