Busch Lab

ZMP

si:ch211-121a2.3

Ensembl ID:
ENSDARG00000034707
ZFIN ID:
ZDB-GENE-070705-22
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8E7M3]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23637 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23637
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043248 Nonsense 128 562 2 10
ENSDART00000136448 None None 225 None 3
Genomic Location (Zv9):
Chromosome 20 (position 7259427)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7094820
GRCz11 20 7084699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAAGACTCTAACAGGTTATTAAGTTACATGACGTCTTCAAACTTGTG[T/A]ATAGGCTACATTCGTCCAAAGTCTGAAAGTAAATACTAGTGTTTTTTAAT
Associated Phenotype:
Not determined