Busch Lab

ZMP

vegfab

Ensembl ID:
ENSDARG00000034700
ZFIN ID:
ZDB-GENE-030131-4605
Description:
vascular endothelial growth factor A [Source:RefSeq peptide;Acc:NP_001038320]
Human Orthologue:
VEGFA
Human Description:
vascular endothelial growth factor A [Source:HGNC Symbol;Acc:12680]
Mouse Orthologue:
Vegfa
Mouse Description:
vascular endothelial growth factor A Gene [Source:MGI Symbol;Acc:MGI:103178]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3505
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017349 Essential Splice Site 227 233 7 8
ENSDART00000033559 Essential Splice Site 188 194 6 7
ENSDART00000103180 Essential Splice Site 244 250 7 8
ENSDART00000103181 Essential Splice Site 246 252 8 9
ENSDART00000109854 Essential Splice Site 144 146 4 5
ENSDART00000132431 Essential Splice Site 245 251 8 9
ENSDART00000136229 Essential Splice Site 222 228 6 7
Genomic Location (Zv9):
Chromosome 4 (position 5462527)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5580708
GRCz11 4 5589278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCCGACTGCAGGTCTAGGCAACTAGAACTCAACGAAAGGACCTGCAGG[T/A]GTGTTTGTAAATCTATACTTTTTTATATCTATCTTCACATGTTGGTGCAA
Associated Phenotype:
Not determined